EMAIL THIS PAGE TO A FRIEND

ZNF407

zinc finger protein 407

UniProtKB ID: Q9C0G0, B5MD54, Q96MY0, Q9H8A1, Q9NXD4, Q9NXD7
Gene ID:
Human(55628) Summary: This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
cow(530360) zinc finger protein 407
sheep(101110722) zinc finger protein 407
domestic guinea pig(100735171) zinc finger protein 407
naked mole-rat(101709343) zinc finger protein 407
chicken(421011) zinc finger protein 407
Horse(100052274) zinc finger protein 407
domestic cat(101096175) zinc finger protein 407
dog(476164) zinc finger protein 407
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017757 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219181 MISSION® esiRNA esiRNA targeting human ZNF407 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017757 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066958 predicted 5237
2 SASI_Hs02_00350573 predicted 2198
3 SASI_Hs02_00350574 predicted 2440
4 SASI_Hs01_00066960 predicted 4202
5 SASI_Hs01_00066961 predicted 2942
6 SASI_Hs01_00066962 predicted 3142
7 SASI_Hs02_00350575 predicted 5479
8 SASI_Hs01_00066963 predicted 2643
9 SASI_Hs01_00066965 predicted 2590
10 SASI_Hs02_00350576 predicted 691
11 SASI_Hs01_00066959 predicted 2577
12 SASI_Hs01_00066964 predicted 1695
13 SASI_Hs01_00066966 predicted 1134
14 SASI_Hs01_00066967 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017757
ZNF407 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 407
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-5236s21c1
Sequence:CCGGTCCCATTTGACTCGGCATAAACTCGAGTTTATGCCGAGTCAAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-5499s21c1
Sequence:CCGGGTCGTACGAGTGCCGTCTAAACTCGAGTTTAGACGGCACTCGTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017757.2-7674s21c1
Sequence:CCGGTGCAGGATTTCTTCGTGATTTCTCGAGAAATCACGAAGAAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-1959s21c1
Sequence:CCGGAGCCACCGAGAAGCATATTAACTCGAGTTAATATGCTTCTCGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-1296s21c1
Sequence:CCGGGCCAAGACCTGAGCGAAATATCTCGAGATATTTCGCTCAGGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2606s1c1
Sequence:CCGGGCCCTGAACAACCACATGAAACTCGAGTTTCATGTGGTTGTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2571s1c1
Sequence:CCGGGCCACTTATGTGATAGAAGTTCTCGAGAACTTCTATCACATAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-1302s1c1
Sequence:CCGGCCTTAAATTGTGAGACAGCAACTCGAGTTGCTGTCTCACAATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-875s1c1
Sequence:CCGGGCAGCAACAGAGAAGCACAAACTCGAGTTTGTGCTTCTCTGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2163s1c1
Sequence:CCGGCCTTTGATTCTGAACAGAATTCTCGAGAATTCTGTTCAGAATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017757
ZNF407 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 407
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-5236s21c1
Sequence:CCGGTCCCATTTGACTCGGCATAAACTCGAGTTTATGCCGAGTCAAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-5499s21c1
Sequence:CCGGGTCGTACGAGTGCCGTCTAAACTCGAGTTTAGACGGCACTCGTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017757.2-7674s21c1
Sequence:CCGGTGCAGGATTTCTTCGTGATTTCTCGAGAAATCACGAAGAAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-1959s21c1
Sequence:CCGGAGCCACCGAGAAGCATATTAACTCGAGTTAATATGCTTCTCGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-1296s21c1
Sequence:CCGGGCCAAGACCTGAGCGAAATATCTCGAGATATTTCGCTCAGGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2606s1c1
Sequence:CCGGGCCCTGAACAACCACATGAAACTCGAGTTTCATGTGGTTGTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2571s1c1
Sequence:CCGGGCCACTTATGTGATAGAAGTTCTCGAGAACTTCTATCACATAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-1302s1c1
Sequence:CCGGCCTTAAATTGTGAGACAGCAACTCGAGTTGCTGTCTCACAATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-875s1c1
Sequence:CCGGGCAGCAACAGAGAAGCACAAACTCGAGTTTGTGCTTCTCTGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2163s1c1
Sequence:CCGGCCTTTGATTCTGAACAGAATTCTCGAGAATTCTGTTCAGAATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017757
ZNF407 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 407
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-5236s21c1
Sequence:CCGGTCCCATTTGACTCGGCATAAACTCGAGTTTATGCCGAGTCAAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-5499s21c1
Sequence:CCGGGTCGTACGAGTGCCGTCTAAACTCGAGTTTAGACGGCACTCGTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017757.2-7674s21c1
Sequence:CCGGTGCAGGATTTCTTCGTGATTTCTCGAGAAATCACGAAGAAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-1959s21c1
Sequence:CCGGAGCCACCGAGAAGCATATTAACTCGAGTTAATATGCTTCTCGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017757.2-1296s21c1
Sequence:CCGGGCCAAGACCTGAGCGAAATATCTCGAGATATTTCGCTCAGGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2606s1c1
Sequence:CCGGGCCCTGAACAACCACATGAAACTCGAGTTTCATGTGGTTGTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2571s1c1
Sequence:CCGGGCCACTTATGTGATAGAAGTTCTCGAGAACTTCTATCACATAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-1302s1c1
Sequence:CCGGCCTTAAATTGTGAGACAGCAACTCGAGTTGCTGTCTCACAATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-875s1c1
Sequence:CCGGGCAGCAACAGAGAAGCACAAACTCGAGTTTGTGCTTCTCTGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017757.1-2163s1c1
Sequence:CCGGCCTTTGATTCTGAACAGAATTCTCGAGAATTCTGTTCAGAATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks