EMAIL THIS PAGE TO A FRIEND

ZNF408

zinc finger protein 408

UniProtKB ID: Q9H9D4
Gene ID:
domestic cat(101089961) zinc finger protein 408
Horse(100057443) zinc finger protein 408
dog(483630) zinc finger protein 408
naked mole-rat(101721369) zinc finger protein 408
Domestic Rabbit(100350628) zinc finger protein 408
domestic guinea pig(100725717) zinc finger protein 408
cow(617377) zinc finger protein 408
sheep(101118474) zinc finger protein 408
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024741 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154121 MISSION® esiRNA esiRNA human ZNF408 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024741 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188021 predicted 979
2 SASI_Hs01_00188022 predicted 1308
3 SASI_Hs01_00188023 predicted 366
4 SASI_Hs01_00188024 predicted 1916
5 SASI_Hs01_00188025 predicted 940
6 SASI_Hs01_00188026 predicted 936
7 SASI_Hs01_00188027 predicted 1412
8 SASI_Hs01_00188028 predicted 328
9 SASI_Hs01_00188029 predicted 1323
10 SASI_Hs02_00357221 predicted 808
11 SASI_Hs01_00188030 predicted 1806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024741
VALIDATED
ZNF408 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 408
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-1328s1c1
Sequence:CCGGCCACCTAAAGAAGCACGCATTCTCGAGAATGCGTGCTTCTTTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-1044s1c1
Sequence:CCGGCCACCTGAACTTCAGAGCAATCTCGAGATTGCTCTGAAGTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_024741.1-2244s1c1
Sequence:CCGGGATGTTGTTGAGGTCACCATTCTCGAGAATGGTGACCTCAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024741.1-864s1c1
Sequence:CCGGGCAGCAGAACCTTGCATAGATCTCGAGATCTATGCAAGGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-552s1c1
Sequence:CCGGCAGGAGGAGAACCTGTCATTACTCGAGTAATGACAGGTTCTCCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1466s21c1
Sequence:CCGGACAATGCGACAAGGCCTATGGCTCGAGCCATAGGCCTTGTCGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1087s21c1
Sequence:CCGGATGGCAGTGGAGCCAGTTTCTCTCGAGAGAAACTGGCTCCACTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-525s21c1
Sequence:CCGGGAGAAGGGCGAGGGAGTAAAGCTCGAGCTTTACTCCCTCGCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-815s21c1
Sequence:CCGGAGAAGTGGAGTCTGCTGTACACTCGAGTGTACAGCAGACTCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-924s21c1
Sequence:CCGGATGGTGAGCCCTGGACTTAAGCTCGAGCTTAAGTCCAGGGCTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-946s21c1
Sequence:CCGGTCCCAACCCAGGACCGAATTTCTCGAGAAATTCGGTCCTGGGTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1402s21c1
Sequence:CCGGGCTCAGAGGAGAGCTTCAAAGCTCGAGCTTTGAAGCTCTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024741
VALIDATED
ZNF408 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 408
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-1328s1c1
Sequence:CCGGCCACCTAAAGAAGCACGCATTCTCGAGAATGCGTGCTTCTTTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-1044s1c1
Sequence:CCGGCCACCTGAACTTCAGAGCAATCTCGAGATTGCTCTGAAGTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_024741.1-2244s1c1
Sequence:CCGGGATGTTGTTGAGGTCACCATTCTCGAGAATGGTGACCTCAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024741.1-864s1c1
Sequence:CCGGGCAGCAGAACCTTGCATAGATCTCGAGATCTATGCAAGGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-552s1c1
Sequence:CCGGCAGGAGGAGAACCTGTCATTACTCGAGTAATGACAGGTTCTCCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1466s21c1
Sequence:CCGGACAATGCGACAAGGCCTATGGCTCGAGCCATAGGCCTTGTCGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1087s21c1
Sequence:CCGGATGGCAGTGGAGCCAGTTTCTCTCGAGAGAAACTGGCTCCACTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-525s21c1
Sequence:CCGGGAGAAGGGCGAGGGAGTAAAGCTCGAGCTTTACTCCCTCGCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-815s21c1
Sequence:CCGGAGAAGTGGAGTCTGCTGTACACTCGAGTGTACAGCAGACTCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-924s21c1
Sequence:CCGGATGGTGAGCCCTGGACTTAAGCTCGAGCTTAAGTCCAGGGCTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-946s21c1
Sequence:CCGGTCCCAACCCAGGACCGAATTTCTCGAGAAATTCGGTCCTGGGTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1402s21c1
Sequence:CCGGGCTCAGAGGAGAGCTTCAAAGCTCGAGCTTTGAAGCTCTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024741
VALIDATED
ZNF408 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 408
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-1328s1c1
Sequence:CCGGCCACCTAAAGAAGCACGCATTCTCGAGAATGCGTGCTTCTTTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-1044s1c1
Sequence:CCGGCCACCTGAACTTCAGAGCAATCTCGAGATTGCTCTGAAGTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_024741.1-2244s1c1
Sequence:CCGGGATGTTGTTGAGGTCACCATTCTCGAGAATGGTGACCTCAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024741.1-864s1c1
Sequence:CCGGGCAGCAGAACCTTGCATAGATCTCGAGATCTATGCAAGGTTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024741.1-552s1c1
Sequence:CCGGCAGGAGGAGAACCTGTCATTACTCGAGTAATGACAGGTTCTCCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1466s21c1
Sequence:CCGGACAATGCGACAAGGCCTATGGCTCGAGCCATAGGCCTTGTCGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1087s21c1
Sequence:CCGGATGGCAGTGGAGCCAGTTTCTCTCGAGAGAAACTGGCTCCACTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-525s21c1
Sequence:CCGGGAGAAGGGCGAGGGAGTAAAGCTCGAGCTTTACTCCCTCGCCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-815s21c1
Sequence:CCGGAGAAGTGGAGTCTGCTGTACACTCGAGTGTACAGCAGACTCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-924s21c1
Sequence:CCGGATGGTGAGCCCTGGACTTAAGCTCGAGCTTAAGTCCAGGGCTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-946s21c1
Sequence:CCGGTCCCAACCCAGGACCGAATTTCTCGAGAAATTCGGTCCTGGGTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024741.1-1402s21c1
Sequence:CCGGGCTCAGAGGAGAGCTTCAAAGCTCGAGCTTTGAAGCTCTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks