EMAIL THIS PAGE TO A FRIEND

ZNF410

zinc finger protein 410

Synonyms: APA-1 APA1
UniProtKB ID: Q86VK4, B4DDV5, B4DR78, O00153, Q9BQ19
Gene ID:
cow(534385) zinc finger protein 410
sheep(101105254) zinc finger protein 410
naked mole-rat(101706787) zinc finger protein 410
Domestic Rabbit(100342741) zinc finger protein 410
domestic guinea pig(100731305) zinc finger protein 410
Zebrafish(402951) zinc finger protein 410
chicken(423340) zinc finger protein 410
Horse(100050679) zinc finger protein 410
domestic cat(101089275) zinc finger protein 410
dog(490776) zinc finger protein 410
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021188 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082811 MISSION® esiRNA esiRNA human ZNF410 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021188 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142145 predicted 834
2 SASI_Hs01_00142146 predicted 493
3 SASI_Hs01_00142147 predicted 1314
4 SASI_Hs01_00142148 predicted 1412
5 SASI_Hs02_00354758 predicted 596
6 SASI_Hs01_00142150 predicted 1664
7 SASI_Hs01_00142151 predicted 332
8 SASI_Hs01_00142152 predicted 1575
9 SASI_Hs01_00142153 predicted 513
10 SASI_Hs01_00142154 predicted 1534
11 SASI_Hs01_00142149 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021188
VALIDATED
ZNF410 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 410
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-852s1c1
Sequence:CCGGGAAGGTTGTGACCGGACATTTCTCGAGAAATGTCCGGTCACAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-1317s1c1
Sequence:CCGGCCACTAATGGGCAGTAGTTTGCTCGAGCAAACTACTGCCCATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-585s1c1
Sequence:CCGGGCTGAGCACTTAGTGTTTGTACTCGAGTACAAACACTAAGTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021188.1-1866s1c1
Sequence:CCGGCCACTGCAAATTTCTGGGATACTCGAGTATCCCAGAAATTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-336s1c1
Sequence:CCGGCGGCTAATGTTACCAGATGATCTCGAGATCATCTGGTAACATTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021188.1-1644s1c1
Sequence:CCGGGCAACTCTATCTGATCTCAAACTCGAGTTTGAGATCAGATAGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021188.1-227s1c1
Sequence:CCGGGTTTGTTCAGAATACGTCCATCTCGAGATGGACGTATTCTGAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021188.1-1695s1c1
Sequence:CCGGCCACAACAGAACCAGAATGAACTCGAGTTCATTCTGGTTCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021188.1-897s1c1
Sequence:CCGGCACCTCAAGACTCATCGAAATCTCGAGATTTCGATGAGTCTTGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-524s1c1
Sequence:CCGGGCCAAGTGATAGCACTTCTTTCTCGAGAAAGAAGTGCTATCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021188
VALIDATED
ZNF410 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 410
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-852s1c1
Sequence:CCGGGAAGGTTGTGACCGGACATTTCTCGAGAAATGTCCGGTCACAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-1317s1c1
Sequence:CCGGCCACTAATGGGCAGTAGTTTGCTCGAGCAAACTACTGCCCATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-585s1c1
Sequence:CCGGGCTGAGCACTTAGTGTTTGTACTCGAGTACAAACACTAAGTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021188.1-1866s1c1
Sequence:CCGGCCACTGCAAATTTCTGGGATACTCGAGTATCCCAGAAATTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-336s1c1
Sequence:CCGGCGGCTAATGTTACCAGATGATCTCGAGATCATCTGGTAACATTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021188.1-1644s1c1
Sequence:CCGGGCAACTCTATCTGATCTCAAACTCGAGTTTGAGATCAGATAGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021188.1-227s1c1
Sequence:CCGGGTTTGTTCAGAATACGTCCATCTCGAGATGGACGTATTCTGAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021188.1-1695s1c1
Sequence:CCGGCCACAACAGAACCAGAATGAACTCGAGTTCATTCTGGTTCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021188.1-897s1c1
Sequence:CCGGCACCTCAAGACTCATCGAAATCTCGAGATTTCGATGAGTCTTGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-524s1c1
Sequence:CCGGGCCAAGTGATAGCACTTCTTTCTCGAGAAAGAAGTGCTATCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021188
VALIDATED
ZNF410 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 410
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-852s1c1
Sequence:CCGGGAAGGTTGTGACCGGACATTTCTCGAGAAATGTCCGGTCACAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-1317s1c1
Sequence:CCGGCCACTAATGGGCAGTAGTTTGCTCGAGCAAACTACTGCCCATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-585s1c1
Sequence:CCGGGCTGAGCACTTAGTGTTTGTACTCGAGTACAAACACTAAGTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021188.1-1866s1c1
Sequence:CCGGCCACTGCAAATTTCTGGGATACTCGAGTATCCCAGAAATTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-336s1c1
Sequence:CCGGCGGCTAATGTTACCAGATGATCTCGAGATCATCTGGTAACATTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021188.1-1644s1c1
Sequence:CCGGGCAACTCTATCTGATCTCAAACTCGAGTTTGAGATCAGATAGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021188.1-227s1c1
Sequence:CCGGGTTTGTTCAGAATACGTCCATCTCGAGATGGACGTATTCTGAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021188.1-1695s1c1
Sequence:CCGGCCACAACAGAACCAGAATGAACTCGAGTTCATTCTGGTTCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021188.1-897s1c1
Sequence:CCGGCACCTCAAGACTCATCGAAATCTCGAGATTTCGATGAGTCTTGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021188.1-524s1c1
Sequence:CCGGGCCAAGTGATAGCACTTCTTTCTCGAGAAAGAAGTGCTATCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks