EMAIL THIS PAGE TO A FRIEND

ZNF414

zinc finger protein 414

Synonyms: ZFP414
UniProtKB ID: Q96IQ9, A8MY94
Gene ID:
chicken(425820) zinc finger protein 414
dog(611636) zinc finger protein 414
domestic cat(101092916) zinc finger protein 414
domestic guinea pig(100714251) zinc finger protein 414
naked mole-rat(101721101) zinc finger protein 414
cow(538455) zinc finger protein 414
sheep(101104314) zinc finger protein 414
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032370 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032370 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070522 predicted 606
2 SASI_Hs01_00070523 predicted 502
3 SASI_Hs01_00070524 predicted 849
4 SASI_Hs01_00070525 predicted 415
5 SASI_Hs01_00070526 predicted 586
6 SASI_Hs01_00070527 predicted 683
7 SASI_Hs01_00070529 predicted 665
8 SASI_Hs01_00070530 predicted 848
9 SASI_Hs01_00070531 predicted 203
10 SASI_Hs02_00359756 predicted 284
11 SASI_Hs01_00070528 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032370
ZNF414 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 414
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032370.1-616s1c1
Sequence:CCGGCCCAATCGCTACTTCAAGTGTCTCGAGACACTTGAAGTAGCGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032370.1-612s1c1
Sequence:CCGGCAAACCCAATCGCTACTTCAACTCGAGTTGAAGTAGCGATTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-596s21c1
Sequence:CCGGACAGCAAACTGCACTACAAACCTCGAGGTTTGTAGTGCAGTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-855s21c1
Sequence:CCGGACCGTTCCTGCCCTACTTGAACTCGAGTTCAAGTAGGGCAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-624s21c1
Sequence:CCGGCTACTTCAAGTGTGAGAACTGCTCGAGCAGTTCTCACACTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-167s21c1
Sequence:CCGGAGACCGACAAGGAGGTGTTGTCTCGAGACAACACCTCCTTGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032370
ZNF414 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 414
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032370.1-616s1c1
Sequence:CCGGCCCAATCGCTACTTCAAGTGTCTCGAGACACTTGAAGTAGCGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032370.1-612s1c1
Sequence:CCGGCAAACCCAATCGCTACTTCAACTCGAGTTGAAGTAGCGATTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-596s21c1
Sequence:CCGGACAGCAAACTGCACTACAAACCTCGAGGTTTGTAGTGCAGTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-855s21c1
Sequence:CCGGACCGTTCCTGCCCTACTTGAACTCGAGTTCAAGTAGGGCAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-624s21c1
Sequence:CCGGCTACTTCAAGTGTGAGAACTGCTCGAGCAGTTCTCACACTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-167s21c1
Sequence:CCGGAGACCGACAAGGAGGTGTTGTCTCGAGACAACACCTCCTTGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032370
ZNF414 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 414
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032370.1-616s1c1
Sequence:CCGGCCCAATCGCTACTTCAAGTGTCTCGAGACACTTGAAGTAGCGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032370.1-612s1c1
Sequence:CCGGCAAACCCAATCGCTACTTCAACTCGAGTTGAAGTAGCGATTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-596s21c1
Sequence:CCGGACAGCAAACTGCACTACAAACCTCGAGGTTTGTAGTGCAGTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-855s21c1
Sequence:CCGGACCGTTCCTGCCCTACTTGAACTCGAGTTCAAGTAGGGCAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-624s21c1
Sequence:CCGGCTACTTCAAGTGTGAGAACTGCTCGAGCAGTTCTCACACTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032370.1-167s21c1
Sequence:CCGGAGACCGACAAGGAGGTGTTGTCTCGAGACAACACCTCCTTGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks