EMAIL THIS PAGE TO A FRIEND

ZNF415

zinc finger protein 415

Gene ID:
cow(539675) zinc finger protein 415
dog(484333) zinc finger protein 415
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018355 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020141 MISSION® esiRNA esiRNA human ZNF415 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018355 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087440 predicted 752
2 SASI_Hs01_00087442 predicted 927
3 SASI_Hs01_00087443 predicted 484
4 SASI_Hs02_00351813 predicted 964
5 SASI_Hs01_00087444 predicted 1695
6 SASI_Hs01_00087445 predicted 879
7 SASI_Hs01_00087446 predicted 241
8 SASI_Hs01_00087447 predicted 1134
9 SASI_Hs02_00351814 predicted 501
10 SASI_Hs01_00087441 predicted 1125
11 SASI_Hs01_00087448 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018355
ZNF415 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 415
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018355.2-1983s21c1
Sequence:CCGGTGCTAAAGAGAAATCATATACCTCGAGGTATATGATTTCTCTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-176s21c1
Sequence:CCGGCTCTACACAGAGGACTTTATACTCGAGTATAAAGTCCTCTGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018355.2-2084s21c1
Sequence:CCGGGTGCATGTTGAAGCTATTAACCTCGAGGTTAATAGCTTCAACATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-1450s21c1
Sequence:CCGGTTAGTGTGCATTCGAACTTAACTCGAGTTAAGTTCGAATGCACACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-489s21c1
Sequence:CCGGGGTATAGGAAACAAGTCTATTCTCGAGAATAGACTTGTTTCCTATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-819s21c1
Sequence:CCGGTCTGGAGAGAAAGGATATAAACTCGAGTTTATATCCTTTCTCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-883s1c1
Sequence:CCGGCGCGTCATTGGAGAGTTCATACTCGAGTATGAACTCTCCAATGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-1718s1c1
Sequence:CCGGCCTCTTCAGACATCAAATTATCTCGAGATAATTTGATGTCTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-762s1c1
Sequence:CCGGGAGTGCGACAAAGCCTTGAATCTCGAGATTCAAGGCTTTGTCGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-1035s1c1
Sequence:CCGGCGAAATTCATGCCTTGCACTACTCGAGTAGTGCAAGGCATGAATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-245s1c1
Sequence:CCGGGTCTCGTAACTGTGTAATCAACTCGAGTTGATTACACAGTTACGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018355
ZNF415 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 415
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018355.2-1983s21c1
Sequence:CCGGTGCTAAAGAGAAATCATATACCTCGAGGTATATGATTTCTCTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-176s21c1
Sequence:CCGGCTCTACACAGAGGACTTTATACTCGAGTATAAAGTCCTCTGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018355.2-2084s21c1
Sequence:CCGGGTGCATGTTGAAGCTATTAACCTCGAGGTTAATAGCTTCAACATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-1450s21c1
Sequence:CCGGTTAGTGTGCATTCGAACTTAACTCGAGTTAAGTTCGAATGCACACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-489s21c1
Sequence:CCGGGGTATAGGAAACAAGTCTATTCTCGAGAATAGACTTGTTTCCTATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-819s21c1
Sequence:CCGGTCTGGAGAGAAAGGATATAAACTCGAGTTTATATCCTTTCTCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-883s1c1
Sequence:CCGGCGCGTCATTGGAGAGTTCATACTCGAGTATGAACTCTCCAATGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-1718s1c1
Sequence:CCGGCCTCTTCAGACATCAAATTATCTCGAGATAATTTGATGTCTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-762s1c1
Sequence:CCGGGAGTGCGACAAAGCCTTGAATCTCGAGATTCAAGGCTTTGTCGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-1035s1c1
Sequence:CCGGCGAAATTCATGCCTTGCACTACTCGAGTAGTGCAAGGCATGAATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-245s1c1
Sequence:CCGGGTCTCGTAACTGTGTAATCAACTCGAGTTGATTACACAGTTACGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018355
ZNF415 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 415
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018355.2-1983s21c1
Sequence:CCGGTGCTAAAGAGAAATCATATACCTCGAGGTATATGATTTCTCTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-176s21c1
Sequence:CCGGCTCTACACAGAGGACTTTATACTCGAGTATAAAGTCCTCTGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018355.2-2084s21c1
Sequence:CCGGGTGCATGTTGAAGCTATTAACCTCGAGGTTAATAGCTTCAACATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-1450s21c1
Sequence:CCGGTTAGTGTGCATTCGAACTTAACTCGAGTTAAGTTCGAATGCACACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-489s21c1
Sequence:CCGGGGTATAGGAAACAAGTCTATTCTCGAGAATAGACTTGTTTCCTATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018355.2-819s21c1
Sequence:CCGGTCTGGAGAGAAAGGATATAAACTCGAGTTTATATCCTTTCTCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-883s1c1
Sequence:CCGGCGCGTCATTGGAGAGTTCATACTCGAGTATGAACTCTCCAATGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-1718s1c1
Sequence:CCGGCCTCTTCAGACATCAAATTATCTCGAGATAATTTGATGTCTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-762s1c1
Sequence:CCGGGAGTGCGACAAAGCCTTGAATCTCGAGATTCAAGGCTTTGTCGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-1035s1c1
Sequence:CCGGCGAAATTCATGCCTTGCACTACTCGAGTAGTGCAAGGCATGAATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018355.2-245s1c1
Sequence:CCGGGTCTCGTAACTGTGTAATCAACTCGAGTTGATTACACAGTTACGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks