EMAIL THIS PAGE TO A FRIEND

ZNF416

zinc finger protein 416

Species: Human ZNF416(55659), domestic cat ZNF416(101095143), cow ZNF416(530973), Domestic Rabbit ZNF416(100346667), domestic guinea pig Znf416(100719550)
UniProtKB ID: Q9BWM5, Q9NWW8
Gene ID:
domestic cat(101095143) zinc finger protein 416
cow(530973) zinc finger protein 416
Domestic Rabbit(100346667) zinc finger protein 416
domestic guinea pig(100719550) zinc finger protein 416
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017879 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072101 MISSION® esiRNA esiRNA human ZNF416 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017879 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064351 predicted 1335
2 SASI_Hs01_00064352 predicted 1512
3 SASI_Hs01_00064353 predicted 1714
4 SASI_Hs01_00064354 predicted 1978
5 SASI_Hs01_00064355 predicted 1373
6 SASI_Hs01_00064356 predicted 1810
7 SASI_Hs01_00064357 predicted 881
8 SASI_Hs01_00064358 predicted 1554
9 SASI_Hs01_00064359 predicted 800
10 SASI_Hs02_00350818 predicted 1941
11 SASI_Hs01_00064350 predicted 1938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017879
VALIDATED
ZNF416 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 416
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_017879.1-736s1c1
Sequence:CCGGCCGCAAGCTATTGCTAACTATCTCGAGATAGTTAGCAATAGCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1515s1c1
Sequence:CCGGCCAAAGAACCACCCTCAATAACTCGAGTTATTGAGGGTGGTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1442s1c1
Sequence:CCGGGCCTCATTCAGCACCAGTTAACTCGAGTTAACTGGTGCTGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-220s1c1
Sequence:CCGGGAAGCTAAACTTATGGGCTTTCTCGAGAAAGCCCATAAGTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-406s1c1
Sequence:CCGGCCTGAGCAAAGTGTTTCTGTACTCGAGTACAGAAACACTTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1442s1c2
Sequence:CCGGGCCTCATTCAGCACCAGTTAACTCGAGTTAACTGGTGCTGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017879.1-2167s21c1
Sequence:CCGGAGGCCTTTGCCAGAGTTAAATCTCGAGATTTAACTCTGGCAAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-465s21c1
Sequence:CCGGATCCACCCAGAAGATTCAATCCTCGAGGATTGAATCTTCTGGGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1096s21c1
Sequence:CCGGCAAAGAGCCACCCTCATTAAACTCGAGTTTAATGAGGGTGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1382s21c1
Sequence:CCGGACACTACAGCAAGGCCTTATGCTCGAGCATAAGGCCTTGCTGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017879.1-2052s21c1
Sequence:CCGGAGCCGTCTGCCTAAAGTTAAACTCGAGTTTAACTTTAGGCAGACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1177s21c1
Sequence:CCGGAGCCAAAGTTCCAACCTTATTCTCGAGAATAAGGTTGGAACTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017879
VALIDATED
ZNF416 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 416
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_017879.1-736s1c1
Sequence:CCGGCCGCAAGCTATTGCTAACTATCTCGAGATAGTTAGCAATAGCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1515s1c1
Sequence:CCGGCCAAAGAACCACCCTCAATAACTCGAGTTATTGAGGGTGGTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1442s1c1
Sequence:CCGGGCCTCATTCAGCACCAGTTAACTCGAGTTAACTGGTGCTGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-220s1c1
Sequence:CCGGGAAGCTAAACTTATGGGCTTTCTCGAGAAAGCCCATAAGTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-406s1c1
Sequence:CCGGCCTGAGCAAAGTGTTTCTGTACTCGAGTACAGAAACACTTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1442s1c2
Sequence:CCGGGCCTCATTCAGCACCAGTTAACTCGAGTTAACTGGTGCTGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017879.1-2167s21c1
Sequence:CCGGAGGCCTTTGCCAGAGTTAAATCTCGAGATTTAACTCTGGCAAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-465s21c1
Sequence:CCGGATCCACCCAGAAGATTCAATCCTCGAGGATTGAATCTTCTGGGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1096s21c1
Sequence:CCGGCAAAGAGCCACCCTCATTAAACTCGAGTTTAATGAGGGTGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1382s21c1
Sequence:CCGGACACTACAGCAAGGCCTTATGCTCGAGCATAAGGCCTTGCTGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017879.1-2052s21c1
Sequence:CCGGAGCCGTCTGCCTAAAGTTAAACTCGAGTTTAACTTTAGGCAGACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1177s21c1
Sequence:CCGGAGCCAAAGTTCCAACCTTATTCTCGAGAATAAGGTTGGAACTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017879
VALIDATED
ZNF416 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 416
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_017879.1-736s1c1
Sequence:CCGGCCGCAAGCTATTGCTAACTATCTCGAGATAGTTAGCAATAGCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1515s1c1
Sequence:CCGGCCAAAGAACCACCCTCAATAACTCGAGTTATTGAGGGTGGTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1442s1c1
Sequence:CCGGGCCTCATTCAGCACCAGTTAACTCGAGTTAACTGGTGCTGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-220s1c1
Sequence:CCGGGAAGCTAAACTTATGGGCTTTCTCGAGAAAGCCCATAAGTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-406s1c1
Sequence:CCGGCCTGAGCAAAGTGTTTCTGTACTCGAGTACAGAAACACTTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017879.1-1442s1c2
Sequence:CCGGGCCTCATTCAGCACCAGTTAACTCGAGTTAACTGGTGCTGAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017879.1-2167s21c1
Sequence:CCGGAGGCCTTTGCCAGAGTTAAATCTCGAGATTTAACTCTGGCAAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-465s21c1
Sequence:CCGGATCCACCCAGAAGATTCAATCCTCGAGGATTGAATCTTCTGGGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1096s21c1
Sequence:CCGGCAAAGAGCCACCCTCATTAAACTCGAGTTTAATGAGGGTGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1382s21c1
Sequence:CCGGACACTACAGCAAGGCCTTATGCTCGAGCATAAGGCCTTGCTGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017879.1-2052s21c1
Sequence:CCGGAGCCGTCTGCCTAAAGTTAAACTCGAGTTTAACTTTAGGCAGACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017879.1-1177s21c1
Sequence:CCGGAGCCAAAGTTCCAACCTTATTCTCGAGAATAAGGTTGGAACTTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks