EMAIL THIS PAGE TO A FRIEND

ZNF417

zinc finger protein 417

Species: Human ZNF417(147687)
UniProtKB ID: Q8TAU3
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0096 AQUA Peptide ISVQ[R] Bordetella pertussis Tohama I, Pseudoalteromonas atlantica T6c, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152475 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366248 predicted 2009
2 SASI_Hs02_00366249 predicted 1947
3 SASI_Hs02_00366250 predicted 1949
4 SASI_Hs01_00197710 predicted 1465
5 SASI_Hs01_00197711 predicted 1752
6 SASI_Hs01_00197712 predicted 869
7 SASI_Hs01_00197713 predicted 1097
8 SASI_Hs01_00197714 predicted 1501
9 SASI_Hs01_00197715 predicted 1575
10 SASI_Hs01_00197716 predicted 620
11 SASI_Hs01_00197717 predicted 667
12 SASI_Hs01_00197718 predicted 634
13 SASI_Hs01_00197719 predicted 1759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152475
ZNF417 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 417
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152475.2-2340s21c1
Sequence:CCGGCACCGTAGCTTGCTTTCTATTCTCGAGAATAGAAAGCAAGCTACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152475.2-1669s21c1
Sequence:CCGGGCCGTATGAATGCAATGAATGCTCGAGCATTCATTGCATTCATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152475.2-1031s21c1
Sequence:CCGGAGTCGAAAGAGCAGCCTTATTCTCGAGAATAAGGCTGCTCTTTCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1249s1c1
Sequence:CCGGCGTCAGAAGTTCTGCTTTATTCTCGAGAATAAAGCAGAACTTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-358s1c1
Sequence:CCGGGCACCTTGTAAGCAGAGAATTCTCGAGAATTCTCTGCTTACAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1850s1c1
Sequence:CCGGCCCTCCTTCATCATCAGAGTTCTCGAGAACTCTGATGATGAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1586s1c1
Sequence:CCGGGTAATAAGAACTGCGTGACTACTCGAGTAGTCACGCAGTTCTTATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-585s1c1
Sequence:CCGGGCAGCATATTGGAGAGAAATTCTCGAGAATTTCTCTCCAATATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152475
ZNF417 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 417
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152475.2-2340s21c1
Sequence:CCGGCACCGTAGCTTGCTTTCTATTCTCGAGAATAGAAAGCAAGCTACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152475.2-1669s21c1
Sequence:CCGGGCCGTATGAATGCAATGAATGCTCGAGCATTCATTGCATTCATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152475.2-1031s21c1
Sequence:CCGGAGTCGAAAGAGCAGCCTTATTCTCGAGAATAAGGCTGCTCTTTCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1249s1c1
Sequence:CCGGCGTCAGAAGTTCTGCTTTATTCTCGAGAATAAAGCAGAACTTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-358s1c1
Sequence:CCGGGCACCTTGTAAGCAGAGAATTCTCGAGAATTCTCTGCTTACAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1850s1c1
Sequence:CCGGCCCTCCTTCATCATCAGAGTTCTCGAGAACTCTGATGATGAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1586s1c1
Sequence:CCGGGTAATAAGAACTGCGTGACTACTCGAGTAGTCACGCAGTTCTTATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-585s1c1
Sequence:CCGGGCAGCATATTGGAGAGAAATTCTCGAGAATTTCTCTCCAATATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152475
ZNF417 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 417
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152475.2-2340s21c1
Sequence:CCGGCACCGTAGCTTGCTTTCTATTCTCGAGAATAGAAAGCAAGCTACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152475.2-1669s21c1
Sequence:CCGGGCCGTATGAATGCAATGAATGCTCGAGCATTCATTGCATTCATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152475.2-1031s21c1
Sequence:CCGGAGTCGAAAGAGCAGCCTTATTCTCGAGAATAAGGCTGCTCTTTCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1249s1c1
Sequence:CCGGCGTCAGAAGTTCTGCTTTATTCTCGAGAATAAAGCAGAACTTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-358s1c1
Sequence:CCGGGCACCTTGTAAGCAGAGAATTCTCGAGAATTCTCTGCTTACAAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1850s1c1
Sequence:CCGGCCCTCCTTCATCATCAGAGTTCTCGAGAACTCTGATGATGAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-1586s1c1
Sequence:CCGGGTAATAAGAACTGCGTGACTACTCGAGTAGTCACGCAGTTCTTATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152475.1-585s1c1
Sequence:CCGGGCAGCATATTGGAGAGAAATTCTCGAGAATTTCTCTCCAATATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks