EMAIL THIS PAGE TO A FRIEND

ZNF418

zinc finger protein 418

UniProtKB ID: Q8TF45, Q2M1S2, Q670L5, Q96N18
Gene ID:
dog(100686546) zinc finger protein 418
domestic cat(101091741) zinc finger protein 418
Horse(100146307) zinc finger protein 418
cow(789960) zinc finger protein 418
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133460 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105127 predicted 968
2 SASI_Hs01_00105128 predicted 2171
3 SASI_Hs01_00105129 predicted 961
4 SASI_Hs01_00105130 predicted 968
5 SASI_Hs01_00105131 predicted 2377
6 SASI_Hs01_00105132 predicted 2401
7 SASI_Hs01_00105133 predicted 2414
8 SASI_Hs01_00105134 predicted 2405
9 SASI_Hs01_00105136 predicted 696
10 SASI_Hs02_00363156 predicted 470
11 SASI_Hs01_00105135 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133460
ZNF418 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 418
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133460.1-2797s1c1
Sequence:CCGGCCCATGATGTTCTGGAAGTAACTCGAGTTACTTCCAGAACATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-965s1c1
Sequence:CCGGCCCTCTAGAGAGGAATGTTATCTCGAGATAACATTCCTCTCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-768s1c1
Sequence:CCGGCTATCTTCATTCAGAGTGGAACTCGAGTTCCACTCTGAATGAAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-668s1c1
Sequence:CCGGCCGCACCAGAATCAGTACCTTCTCGAGAAGGTACTGATTCTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-1445s1c1
Sequence:CCGGCTAACTGAACATCATCGAGTTCTCGAGAACTCGATGATGTTCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-2092s21c1
Sequence:CCGGTACTCGAAGGTCTGCGCATTTCTCGAGAAATGCGCAGACCTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-396s21c1
Sequence:CCGGTGGAGAACTGGGTACTTATATCTCGAGATATAAGTACCCAGTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-1658s21c1
Sequence:CCGGTGTAGAGAGTGTAGGAAATTACTCGAGTAATTTCCTACACTCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-926s21c1
Sequence:CCGGTCTAGCACCAAACACGTATTTCTCGAGAAATACGTGTTTGGTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133460.1-2619s21c1
Sequence:CCGGACGGAGCCATCTGCCTAAATTCTCGAGAATTTAGGCAGATGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133460
ZNF418 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 418
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133460.1-2797s1c1
Sequence:CCGGCCCATGATGTTCTGGAAGTAACTCGAGTTACTTCCAGAACATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-965s1c1
Sequence:CCGGCCCTCTAGAGAGGAATGTTATCTCGAGATAACATTCCTCTCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-768s1c1
Sequence:CCGGCTATCTTCATTCAGAGTGGAACTCGAGTTCCACTCTGAATGAAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-668s1c1
Sequence:CCGGCCGCACCAGAATCAGTACCTTCTCGAGAAGGTACTGATTCTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-1445s1c1
Sequence:CCGGCTAACTGAACATCATCGAGTTCTCGAGAACTCGATGATGTTCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-2092s21c1
Sequence:CCGGTACTCGAAGGTCTGCGCATTTCTCGAGAAATGCGCAGACCTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-396s21c1
Sequence:CCGGTGGAGAACTGGGTACTTATATCTCGAGATATAAGTACCCAGTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-1658s21c1
Sequence:CCGGTGTAGAGAGTGTAGGAAATTACTCGAGTAATTTCCTACACTCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-926s21c1
Sequence:CCGGTCTAGCACCAAACACGTATTTCTCGAGAAATACGTGTTTGGTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133460.1-2619s21c1
Sequence:CCGGACGGAGCCATCTGCCTAAATTCTCGAGAATTTAGGCAGATGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133460
ZNF418 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 418
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133460.1-2797s1c1
Sequence:CCGGCCCATGATGTTCTGGAAGTAACTCGAGTTACTTCCAGAACATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-965s1c1
Sequence:CCGGCCCTCTAGAGAGGAATGTTATCTCGAGATAACATTCCTCTCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-768s1c1
Sequence:CCGGCTATCTTCATTCAGAGTGGAACTCGAGTTCCACTCTGAATGAAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-668s1c1
Sequence:CCGGCCGCACCAGAATCAGTACCTTCTCGAGAAGGTACTGATTCTGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133460.1-1445s1c1
Sequence:CCGGCTAACTGAACATCATCGAGTTCTCGAGAACTCGATGATGTTCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-2092s21c1
Sequence:CCGGTACTCGAAGGTCTGCGCATTTCTCGAGAAATGCGCAGACCTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-396s21c1
Sequence:CCGGTGGAGAACTGGGTACTTATATCTCGAGATATAAGTACCCAGTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-1658s21c1
Sequence:CCGGTGTAGAGAGTGTAGGAAATTACTCGAGTAATTTCCTACACTCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133460.1-926s21c1
Sequence:CCGGTCTAGCACCAAACACGTATTTCTCGAGAAATACGTGTTTGGTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133460.1-2619s21c1
Sequence:CCGGACGGAGCCATCTGCCTAAATTCTCGAGAATTTAGGCAGATGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks