EMAIL THIS PAGE TO A FRIEND

ZNF419

zinc finger protein 419

Synonyms: ZNF419A
Gene ID:
cow(510702) zinc finger protein 419
sheep(101105270) zinc finger protein 419
domestic cat(101098592) zinc finger protein 419
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098491 Rosetta Predictions human pricing
NM_001098492 Rosetta Predictions human pricing
NM_001098493 Rosetta Predictions human pricing
NM_001098494 Rosetta Predictions human pricing
NM_001098495 Rosetta Predictions human pricing
NM_001098496 Rosetta Predictions human pricing
NM_024691 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319009 predicted 1851
2 SASI_Hs02_00319010 predicted 1471
3 SASI_Hs02_00319011 predicted 1461
4 SASI_Hs02_00319012 predicted 1319
5 SASI_Hs02_00319013 predicted 1461
6 SASI_Hs02_00319014 predicted 1623
7 SASI_Hs02_00319015 predicted 1049
8 SASI_Hs02_00319016 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319017 predicted 1815
2 SASI_Hs02_00319018 predicted 1428
3 SASI_Hs02_00319019 predicted 1422
4 SASI_Hs02_00319020 predicted 1274
5 SASI_Hs02_00319021 predicted 1429
6 SASI_Hs02_00319022 predicted 1578
7 SASI_Hs02_00319023 predicted 1009
8 SASI_Hs02_00319024 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319025 predicted 1814
2 SASI_Hs02_00319026 predicted 1426
3 SASI_Hs02_00319027 predicted 1428
4 SASI_Hs02_00319028 predicted 1276
5 SASI_Hs02_00319029 predicted 1417
6 SASI_Hs02_00319030 predicted 1578
7 SASI_Hs02_00319031 predicted 1003
8 SASI_Hs02_00319032 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319033 predicted 1754
2 SASI_Hs02_00319034 predicted 1368
3 SASI_Hs02_00319035 predicted 1369
4 SASI_Hs02_00319036 predicted 1214
5 SASI_Hs02_00319037 predicted 1366
6 SASI_Hs02_00319038 predicted 1523
7 SASI_Hs02_00319039 predicted 950
8 SASI_Hs02_00319040 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319041 predicted 1714
2 SASI_Hs02_00319042 predicted 1329
3 SASI_Hs02_00319043 predicted 1328
4 SASI_Hs02_00319044 predicted 1179
5 SASI_Hs02_00319045 predicted 1325
6 SASI_Hs02_00319046 predicted 1481
7 SASI_Hs02_00319047 predicted 907
8 SASI_Hs02_00319048 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319049 predicted 1709
2 SASI_Hs02_00319050 predicted 1326
3 SASI_Hs02_00319051 predicted 1320
4 SASI_Hs02_00319052 predicted 1169
5 SASI_Hs02_00319053 predicted 1322
6 SASI_Hs02_00319054 predicted 1481
7 SASI_Hs02_00319055 predicted 901
8 SASI_Hs02_00319056 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188970 predicted 1847
2 SASI_Hs01_00188971 predicted 1462
3 SASI_Hs01_00188972 predicted 1461
4 SASI_Hs01_00188973 predicted 1310
5 SASI_Hs01_00188974 predicted 1458
6 SASI_Hs01_00188975 predicted 1615
7 SASI_Hs01_00188976 predicted 1044
8 SASI_Hs01_00188977 predicted 1617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024691
ZNF419 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 419
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024691.3-1993s21c1
Sequence:CCGGGCCTTAGGGTGACAGGTTATGCTCGAGCATAACCTGTCACCCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024691.3-1899s21c1
Sequence:CCGGCAGTTTACAATGTGGACAATGCTCGAGCATTGTCCACATTGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024691.3-684s21c1
Sequence:CCGGGAGTTGCAAAGTTCACCTATCCTCGAGGATAGGTGAACTTTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024691.3-300s21c1
Sequence:CCGGAGACCATGAGGAGGGCTATGTCTCGAGACATAGCCCTCCTCATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-530s1c1
Sequence:CCGGCTTCTGTAGGACTGCTCAGTTCTCGAGAACTGAGCAGTCCTACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-892s1c1
Sequence:CCGGTGTGGGAAGTTATTTAGAGATCTCGAGATCTCTAAATAACTTCCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-1690s1c1
Sequence:CCGGCGAAGGATTCACACTGGAGAACTCGAGTTCTCCAGTGTGAATCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-1421s1c1
Sequence:CCGGCCACCCTAGTTAGACATCAGACTCGAGTCTGATGTCTAACTAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-963s1c1
Sequence:CCGGCGGGTGTAGTAACTGTGGAAACTCGAGTTTCCACAGTTACTACACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024691
ZNF419 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 419
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024691.3-1993s21c1
Sequence:CCGGGCCTTAGGGTGACAGGTTATGCTCGAGCATAACCTGTCACCCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024691.3-1899s21c1
Sequence:CCGGCAGTTTACAATGTGGACAATGCTCGAGCATTGTCCACATTGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024691.3-684s21c1
Sequence:CCGGGAGTTGCAAAGTTCACCTATCCTCGAGGATAGGTGAACTTTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024691.3-300s21c1
Sequence:CCGGAGACCATGAGGAGGGCTATGTCTCGAGACATAGCCCTCCTCATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-530s1c1
Sequence:CCGGCTTCTGTAGGACTGCTCAGTTCTCGAGAACTGAGCAGTCCTACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-892s1c1
Sequence:CCGGTGTGGGAAGTTATTTAGAGATCTCGAGATCTCTAAATAACTTCCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-1690s1c1
Sequence:CCGGCGAAGGATTCACACTGGAGAACTCGAGTTCTCCAGTGTGAATCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-1421s1c1
Sequence:CCGGCCACCCTAGTTAGACATCAGACTCGAGTCTGATGTCTAACTAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-963s1c1
Sequence:CCGGCGGGTGTAGTAACTGTGGAAACTCGAGTTTCCACAGTTACTACACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024691
ZNF419 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 419
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024691.3-1993s21c1
Sequence:CCGGGCCTTAGGGTGACAGGTTATGCTCGAGCATAACCTGTCACCCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024691.3-1899s21c1
Sequence:CCGGCAGTTTACAATGTGGACAATGCTCGAGCATTGTCCACATTGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024691.3-684s21c1
Sequence:CCGGGAGTTGCAAAGTTCACCTATCCTCGAGGATAGGTGAACTTTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024691.3-300s21c1
Sequence:CCGGAGACCATGAGGAGGGCTATGTCTCGAGACATAGCCCTCCTCATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-530s1c1
Sequence:CCGGCTTCTGTAGGACTGCTCAGTTCTCGAGAACTGAGCAGTCCTACAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-892s1c1
Sequence:CCGGTGTGGGAAGTTATTTAGAGATCTCGAGATCTCTAAATAACTTCCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-1690s1c1
Sequence:CCGGCGAAGGATTCACACTGGAGAACTCGAGTTCTCCAGTGTGAATCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-1421s1c1
Sequence:CCGGCCACCCTAGTTAGACATCAGACTCGAGTCTGATGTCTAACTAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024691.2-963s1c1
Sequence:CCGGCGGGTGTAGTAACTGTGGAAACTCGAGTTTCCACAGTTACTACACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks