EMAIL THIS PAGE TO A FRIEND

ZNF41

zinc finger protein 41

Synonyms: MRX89
Gene ID:
Human(7592) Summary: This gene product is a likely zinc finger family transcription factor. It contains KRAB-A and KRAB-B domains that act as transcriptional repressors in related proteins, and multiple zinc finger DNA binding motifs and finger linking regions characteristic of the Kruppel family. This gene is part of a gene cluster on chromosome Xp11.23. Several alternatively spliced transcript variants have been described, however, the full-length nature of only some of them is known. [provided by RefSeq, Jul 2008]
cow(531674) zinc finger protein 41
sheep(101116888) zinc finger protein 41
naked mole-rat(101697871) zinc finger protein 41
Zebrafish(553302) ZNF41 protein
Horse(100060982) zinc finger protein 41
domestic cat(101097134) zinc finger protein 41
dog(480899) zinc finger protein 41
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412086 ANTI-ZNF41 antibody produced in mouse clone 3E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412087 ANTI-ZNF41 antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412088 ANTI-ZNF41 antibody produced in mouse clone 1E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412089 ANTI-ZNF41 antibody produced in mouse clone 2F9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412090 ANTI-ZNF41 antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412091 ANTI-ZNF41 antibody produced in mouse clone 4E5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412092 ANTI-ZNF41 antibody produced in mouse clone 2F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412093 ANTI-ZNF41 antibody produced in mouse clone 2D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102870 Anti-ZNF41 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rat, zebrafish, canine, bovine, human, horse, rabbit
western blot pricing
HPA069102 Anti-ZNF41 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0007592M1 Monoclonal Anti-ZNF41 antibody produced in mouse clone 4E9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404543 Monoclonal Anti-ZNF41 antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007130 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007130 Rosetta Predictions human pricing
NM_153380 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035996 predicted 964
2 SASI_Hs02_00343018 predicted 1765
3 SASI_Hs01_00035997 predicted 1487
4 SASI_Hs01_00035998 predicted 2607
5 SASI_Hs01_00035999 predicted 1047
6 SASI_Hs01_00036000 predicted 1142
7 SASI_Hs01_00036001 predicted 2915
8 SASI_Hs01_00036002 predicted 1587
9 SASI_Hs01_00036003 predicted 2073
10 SASI_Hs01_00036004 predicted 1858
11 SASI_Hs01_00036005 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013301 predicted 833
2 SASI_Hs02_00367273 predicted 1640
3 SASI_Hs01_00013302 predicted 1359
4 SASI_Hs01_00013303 predicted 2474
5 SASI_Hs01_00013304 predicted 922
6 SASI_Hs01_00013305 predicted 1016
7 SASI_Hs01_00013306 predicted 2785
8 SASI_Hs01_00013307 predicted 1466
9 SASI_Hs01_00013308 predicted 1942
10 SASI_Hs01_00013309 predicted 1732
11 SASI_Hs01_00013310 predicted 1236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007130
ZNF41 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 41
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007130.2-1307s21c1
Sequence:CCGGCAAGCTTGTTCCTTCAATTAACTCGAGTTAATTGAAGGAACAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007130.2-2778s21c1
Sequence:CCGGGCCTTCACTGACCGATCAAATCTCGAGATTTGATCGGTCAGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007130.2-3359s21c1
Sequence:CCGGGTTTGGTGACATGATTCATACCTCGAGGTATGAATCATGTCACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007130.1-2758s1c1
Sequence:CCGGCCTGGAAATCACAACTGGGTACTCGAGTACCCAGTTGTGATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-2669s1c1
Sequence:CCGGGCCTTTACTGACAGATCGAATCTCGAGATTCGATCTGTCAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-1416s1c1
Sequence:CCGGCCCTCAAATCAAACCTCATTACTCGAGTAATGAGGTTTGATTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-1623s1c1
Sequence:CCGGCCGGAGAGAAACACTATGAATCTCGAGATTCATAGTGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-776s1c1
Sequence:CCGGCCCATAGGAGAAGATTCATTACTCGAGTAATGAATCTTCTCCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007130
ZNF41 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 41
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007130.2-1307s21c1
Sequence:CCGGCAAGCTTGTTCCTTCAATTAACTCGAGTTAATTGAAGGAACAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007130.2-2778s21c1
Sequence:CCGGGCCTTCACTGACCGATCAAATCTCGAGATTTGATCGGTCAGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007130.2-3359s21c1
Sequence:CCGGGTTTGGTGACATGATTCATACCTCGAGGTATGAATCATGTCACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007130.1-2758s1c1
Sequence:CCGGCCTGGAAATCACAACTGGGTACTCGAGTACCCAGTTGTGATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-2669s1c1
Sequence:CCGGGCCTTTACTGACAGATCGAATCTCGAGATTCGATCTGTCAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-1416s1c1
Sequence:CCGGCCCTCAAATCAAACCTCATTACTCGAGTAATGAGGTTTGATTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-1623s1c1
Sequence:CCGGCCGGAGAGAAACACTATGAATCTCGAGATTCATAGTGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-776s1c1
Sequence:CCGGCCCATAGGAGAAGATTCATTACTCGAGTAATGAATCTTCTCCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007130
ZNF41 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 41
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007130.2-1307s21c1
Sequence:CCGGCAAGCTTGTTCCTTCAATTAACTCGAGTTAATTGAAGGAACAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007130.2-2778s21c1
Sequence:CCGGGCCTTCACTGACCGATCAAATCTCGAGATTTGATCGGTCAGTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007130.2-3359s21c1
Sequence:CCGGGTTTGGTGACATGATTCATACCTCGAGGTATGAATCATGTCACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007130.1-2758s1c1
Sequence:CCGGCCTGGAAATCACAACTGGGTACTCGAGTACCCAGTTGTGATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-2669s1c1
Sequence:CCGGGCCTTTACTGACAGATCGAATCTCGAGATTCGATCTGTCAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-1416s1c1
Sequence:CCGGCCCTCAAATCAAACCTCATTACTCGAGTAATGAGGTTTGATTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-1623s1c1
Sequence:CCGGCCGGAGAGAAACACTATGAATCTCGAGATTCATAGTGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007130.1-776s1c1
Sequence:CCGGCCCATAGGAGAAGATTCATTACTCGAGTAATGAATCTTCTCCTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks