EMAIL THIS PAGE TO A FRIEND

ZNF420

zinc finger protein 420

Synonyms: APAK
UniProtKB ID: Q8TAQ5, B2RDY6
Gene ID:
chicken(100859488) zinc finger protein 420
Horse(100062389) zinc finger protein 420
dog(484545) zinc finger protein 420
cow(100124518) zinc finger protein 420
Domestic Rabbit(100346786) zinc finger protein 420
naked mole-rat(101699634) zinc finger protein 420
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144689 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215657 predicted 2266
2 SASI_Hs01_00215658 predicted 1087
3 SASI_Hs01_00215660 predicted 1003
4 SASI_Hs01_00215661 predicted 352
5 SASI_Hs02_00364608 predicted 1320
6 SASI_Hs02_00364609 predicted 992
7 SASI_Hs01_00215663 predicted 1835
8 SASI_Hs01_00215665 predicted 2232
9 SASI_Hs01_00215666 predicted 2277
10 SASI_Hs02_00364610 predicted 363
11 SASI_Hs01_00215659 predicted 2079
12 SASI_Hs01_00215662 predicted 292
13 SASI_Hs01_00215664 predicted 2320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144689
VALIDATED
ZNF420 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 420
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_144689.3-1839s1c1
Sequence:CCGGCGTGGCTTACTACTTATACAACTCGAGTTGTATAAGTAGTAAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_144689.3-595s1c1
Sequence:CCGGCTCAACATTCAAGATGTCATTCTCGAGAATGACATCTTGAATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144689.3-2082s1c1
Sequence:CCGGGCCTTTACTCAGAGTTCACATCTCGAGATGTGAACTCTGAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144689.3-674s1c1
Sequence:CCGGCCTAACACAACATCAAAGTATCTCGAGATACTTTGATGTTGTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144689.3-747s1c1
Sequence:CCGGCGTGATTCACAACTCAGTCTTCTCGAGAAGACTGAGTTGTGAATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-452s21c1
Sequence:CCGGTGATCTTGAAGAGTCCAATTCCTCGAGGAATTGGACTCTTCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144689.3-2780s21c1
Sequence:CCGGGAGAGTACTTATGAGTATAATCTCGAGATTATACTCATAAGTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-537s21c1
Sequence:CCGGAGGCAAGGGATGATCATATATCTCGAGATATATGATCATCCCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-357s21c1
Sequence:CCGGCCTTCAAGGTGTGCAAGTAAGCTCGAGCTTACTTGCACACCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-1518s21c1
Sequence:CCGGACACGACACCAGAGGATTCATCTCGAGATGAATCCTCTGGTGTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144689.3-2712s21c1
Sequence:CCGGGAACGTAGCATACCACAAATACTCGAGTATTTGTGGTATGCTACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144689
VALIDATED
ZNF420 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 420
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_144689.3-1839s1c1
Sequence:CCGGCGTGGCTTACTACTTATACAACTCGAGTTGTATAAGTAGTAAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_144689.3-595s1c1
Sequence:CCGGCTCAACATTCAAGATGTCATTCTCGAGAATGACATCTTGAATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144689.3-2082s1c1
Sequence:CCGGGCCTTTACTCAGAGTTCACATCTCGAGATGTGAACTCTGAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144689.3-674s1c1
Sequence:CCGGCCTAACACAACATCAAAGTATCTCGAGATACTTTGATGTTGTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144689.3-747s1c1
Sequence:CCGGCGTGATTCACAACTCAGTCTTCTCGAGAAGACTGAGTTGTGAATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-452s21c1
Sequence:CCGGTGATCTTGAAGAGTCCAATTCCTCGAGGAATTGGACTCTTCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144689.3-2780s21c1
Sequence:CCGGGAGAGTACTTATGAGTATAATCTCGAGATTATACTCATAAGTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-537s21c1
Sequence:CCGGAGGCAAGGGATGATCATATATCTCGAGATATATGATCATCCCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-357s21c1
Sequence:CCGGCCTTCAAGGTGTGCAAGTAAGCTCGAGCTTACTTGCACACCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-1518s21c1
Sequence:CCGGACACGACACCAGAGGATTCATCTCGAGATGAATCCTCTGGTGTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144689.3-2712s21c1
Sequence:CCGGGAACGTAGCATACCACAAATACTCGAGTATTTGTGGTATGCTACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144689
VALIDATED
ZNF420 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 420
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_144689.3-1839s1c1
Sequence:CCGGCGTGGCTTACTACTTATACAACTCGAGTTGTATAAGTAGTAAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_144689.3-595s1c1
Sequence:CCGGCTCAACATTCAAGATGTCATTCTCGAGAATGACATCTTGAATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144689.3-2082s1c1
Sequence:CCGGGCCTTTACTCAGAGTTCACATCTCGAGATGTGAACTCTGAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144689.3-674s1c1
Sequence:CCGGCCTAACACAACATCAAAGTATCTCGAGATACTTTGATGTTGTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144689.3-747s1c1
Sequence:CCGGCGTGATTCACAACTCAGTCTTCTCGAGAAGACTGAGTTGTGAATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-452s21c1
Sequence:CCGGTGATCTTGAAGAGTCCAATTCCTCGAGGAATTGGACTCTTCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144689.3-2780s21c1
Sequence:CCGGGAGAGTACTTATGAGTATAATCTCGAGATTATACTCATAAGTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-537s21c1
Sequence:CCGGAGGCAAGGGATGATCATATATCTCGAGATATATGATCATCCCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-357s21c1
Sequence:CCGGCCTTCAAGGTGTGCAAGTAAGCTCGAGCTTACTTGCACACCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144689.3-1518s21c1
Sequence:CCGGACACGACACCAGAGGATTCATCTCGAGATGAATCCTCTGGTGTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144689.3-2712s21c1
Sequence:CCGGGAACGTAGCATACCACAAATACTCGAGTATTTGTGGTATGCTACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks