EMAIL THIS PAGE TO A FRIEND

ZNF423

zinc finger protein 423

Synonyms: Ebfaz JBTS19 NPHP14 OAZ Roaz ZFP423 Zfp104
UniProtKB ID: Q2M1K9, O94860, Q76N04, Q9NZ13
Gene ID:
Human(23090) Summary: The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
naked mole-rat(101715350) zinc finger protein 423
domestic guinea pig(100726152) zinc finger protein 423
cow(508025) zinc finger protein 423
sheep(101111898) zinc finger protein 423
Zebrafish(325643) zinc finger protein 423
Horse(100058325) zinc finger protein 423
domestic cat(101090980) zinc finger protein 423
dog(487291) zinc finger protein 423
chicken(415738) zinc finger protein 423
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108754 Anti-ZNF423 affinity isolated antibody bovine, guinea pig, mouse, rabbit, zebrafish, canine, rat, human, horse
western blot pricing
SAB2104426 Anti-ZNF423 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, horse, zebrafish, bovine, canine, mouse, rat
western blot pricing
HPA015258 Anti-ZNF423 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA065820 Anti-ZNF423 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015069 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023111 MISSION® esiRNA esiRNA human ZNF423 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015069 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160938 predicted 1306
2 SASI_Hs01_00160939 predicted 847
3 SASI_Hs01_00160940 predicted 3169
4 SASI_Hs01_00160941 predicted 2942
5 SASI_Hs01_00160942 predicted 4237
6 SASI_Hs02_00346928 predicted 435
7 SASI_Hs01_00160943 predicted 1534
8 SASI_Hs01_00160944 predicted 2521
9 SASI_Hs01_00160945 predicted 3875
10 SASI_Hs01_00160946 predicted 1751
11 SASI_Hs01_00160947 predicted 3112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015069
VALIDATED
ZNF423 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 423
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-2188s21c1
Sequence:CCGGGGAGTATCCTTGCAATCAATGCTCGAGCATTGATTGCAAGGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-2029s21c1
Sequence:CCGGCCTGAAACTCACCAAGCACATCTCGAGATGTGCTTGGTGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-1968s21c1
Sequence:CCGGAGTCCTTCATGGAGGTCTATTCTCGAGAATAGACCTCCATGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015069.2-1536s21c1
Sequence:CCGGATTGTTCCAAGCGGGACTTTACTCGAGTAAAGTCCCGCTTGGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015069.2-4219s21c1
Sequence:CCGGGAACATTACATCCAATCAAAGCTCGAGCTTTGATTGGATGTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015069.1-3677s1c1
Sequence:CCGGGTCAAGTTTGAGAGTGCCGAACTCGAGTTCGGCACTCTCAAACTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015069.1-1831s1c1
Sequence:CCGGTGACGGTAATAATGCTTTCTTCTCGAGAAGAAAGCATTATTACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015069.1-3865s1c1
Sequence:CCGGCCACATGATTGAGGAAGGCATCTCGAGATGCCTTCCTCAATCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015069.1-3093s1c1
Sequence:CCGGGCAACGTTTGTTCACGGACTTCTCGAGAAGTCCGTGAACAAACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015069
VALIDATED
ZNF423 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 423
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-2188s21c1
Sequence:CCGGGGAGTATCCTTGCAATCAATGCTCGAGCATTGATTGCAAGGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-2029s21c1
Sequence:CCGGCCTGAAACTCACCAAGCACATCTCGAGATGTGCTTGGTGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-1968s21c1
Sequence:CCGGAGTCCTTCATGGAGGTCTATTCTCGAGAATAGACCTCCATGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015069.2-1536s21c1
Sequence:CCGGATTGTTCCAAGCGGGACTTTACTCGAGTAAAGTCCCGCTTGGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015069.2-4219s21c1
Sequence:CCGGGAACATTACATCCAATCAAAGCTCGAGCTTTGATTGGATGTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015069.1-3677s1c1
Sequence:CCGGGTCAAGTTTGAGAGTGCCGAACTCGAGTTCGGCACTCTCAAACTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015069.1-1831s1c1
Sequence:CCGGTGACGGTAATAATGCTTTCTTCTCGAGAAGAAAGCATTATTACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015069.1-3865s1c1
Sequence:CCGGCCACATGATTGAGGAAGGCATCTCGAGATGCCTTCCTCAATCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015069.1-3093s1c1
Sequence:CCGGGCAACGTTTGTTCACGGACTTCTCGAGAAGTCCGTGAACAAACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015069
VALIDATED
ZNF423 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 423
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-2188s21c1
Sequence:CCGGGGAGTATCCTTGCAATCAATGCTCGAGCATTGATTGCAAGGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-2029s21c1
Sequence:CCGGCCTGAAACTCACCAAGCACATCTCGAGATGTGCTTGGTGAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015069.2-1968s21c1
Sequence:CCGGAGTCCTTCATGGAGGTCTATTCTCGAGAATAGACCTCCATGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015069.2-1536s21c1
Sequence:CCGGATTGTTCCAAGCGGGACTTTACTCGAGTAAAGTCCCGCTTGGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015069.2-4219s21c1
Sequence:CCGGGAACATTACATCCAATCAAAGCTCGAGCTTTGATTGGATGTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015069.1-3677s1c1
Sequence:CCGGGTCAAGTTTGAGAGTGCCGAACTCGAGTTCGGCACTCTCAAACTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015069.1-1831s1c1
Sequence:CCGGTGACGGTAATAATGCTTTCTTCTCGAGAAGAAAGCATTATTACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015069.1-3865s1c1
Sequence:CCGGCCACATGATTGAGGAAGGCATCTCGAGATGCCTTCCTCAATCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015069.1-3093s1c1
Sequence:CCGGGCAACGTTTGTTCACGGACTTCTCGAGAAGTCCGTGAACAAACGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks