EMAIL THIS PAGE TO A FRIEND

ZNF425

zinc finger protein 425

UniProtKB ID: Q6IV72, B3KPM1, Q08AG3
Gene ID:
domestic cat(101088070) zinc finger protein 425
Horse(100060670) zinc finger protein 425
dog(482782) zinc finger protein 425
naked mole-rat(101700608) zinc finger protein 425
Domestic Rabbit(100353522) zinc finger protein 425
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA020087 Anti-ZNF425 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374579 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103101 MISSION® esiRNA esiRNA human ZNF425 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053895 predicted 323
2 SASI_Hs01_00053896 predicted 233
3 SASI_Hs01_00053897 predicted 1983
4 SASI_Hs01_00053899 predicted 2108
5 SASI_Hs01_00053900 predicted 649
6 SASI_Hs02_00303858 predicted 1233
7 SASI_Hs02_00303859 predicted 2115
8 SASI_Hs01_00053901 predicted 548
9 SASI_Hs01_00053902 predicted 1557
10 SASI_Hs01_00053904 predicted 263
11 SASI_Hs01_00053898 predicted 518
12 SASI_Hs01_00053903 predicted 729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374579
ZNF425 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 425
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374579.1-2446s1c1
Sequence:CCGGCGCCTGTAATCCCATTACTTTCTCGAGAAAGTAATGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-458s1c1
Sequence:CCGGCGAGGGAAAGAGAGAAAGATTCTCGAGAATCTTTCTCTCTTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-666s1c1
Sequence:CCGGTCTTCCAAGTAAGGAGGGATTCTCGAGAATCCCTCCTTACTTGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-282s1c1
Sequence:CCGGGCGAACAGGGATGCTTAGATACTCGAGTATCTAAGCATCCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-516s1c1
Sequence:CCGGTCCGAGAAACAGAGATTCTAACTCGAGTTAGAATCTCTGTTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374579
ZNF425 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 425
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374579.1-2446s1c1
Sequence:CCGGCGCCTGTAATCCCATTACTTTCTCGAGAAAGTAATGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-458s1c1
Sequence:CCGGCGAGGGAAAGAGAGAAAGATTCTCGAGAATCTTTCTCTCTTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-666s1c1
Sequence:CCGGTCTTCCAAGTAAGGAGGGATTCTCGAGAATCCCTCCTTACTTGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-282s1c1
Sequence:CCGGGCGAACAGGGATGCTTAGATACTCGAGTATCTAAGCATCCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-516s1c1
Sequence:CCGGTCCGAGAAACAGAGATTCTAACTCGAGTTAGAATCTCTGTTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374579
ZNF425 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 425
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_374579.1-2446s1c1
Sequence:CCGGCGCCTGTAATCCCATTACTTTCTCGAGAAAGTAATGGGATTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-458s1c1
Sequence:CCGGCGAGGGAAAGAGAGAAAGATTCTCGAGAATCTTTCTCTCTTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-666s1c1
Sequence:CCGGTCTTCCAAGTAAGGAGGGATTCTCGAGAATCCCTCCTTACTTGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-282s1c1
Sequence:CCGGGCGAACAGGGATGCTTAGATACTCGAGTATCTAAGCATCCCTGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374579.1-516s1c1
Sequence:CCGGTCCGAGAAACAGAGATTCTAACTCGAGTTAGAATCTCTGTTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks