EMAIL THIS PAGE TO A FRIEND

ZNF426

zinc finger protein 426

Species: Human ZNF426(79088), Domestic Rabbit ZNF426(100348700), naked mole-rat Znf426(101705877), domestic guinea pig Znf426(100719728)
UniProtKB ID: Q9BUY5, B3KTL2
Gene ID:
Domestic Rabbit(100348700) zinc finger protein 426
naked mole-rat(101705877) zinc finger protein 426
domestic guinea pig(100719728) zinc finger protein 426
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024106 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027901 MISSION® esiRNA esiRNA human ZNF426 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024106 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228437 predicted 649
2 SASI_Hs01_00228438 predicted 1210
3 SASI_Hs01_00228439 predicted 595
4 SASI_Hs01_00228440 predicted 1305
5 SASI_Hs02_00356590 predicted 1717
6 SASI_Hs02_00356591 predicted 509
7 SASI_Hs02_00356592 predicted 1060
8 SASI_Hs02_00356593 predicted 1120
9 SASI_Hs01_00228432 predicted 891
10 SASI_Hs01_00228433 predicted 1054
11 SASI_Hs01_00228434 predicted 895
12 SASI_Hs01_00228435 predicted 1722
13 SASI_Hs01_00228436 predicted 1061
14 SASI_Hs01_00228441 predicted 1816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024106
VALIDATED
ZNF426 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 426
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-1383s1c1
Sequence:CCGGCCTTACATCCTCACGCCTTATCTCGAGATAAGGCGTGAGGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-833s1c1
Sequence:CCGGCCTCTACTGGTGAGAAACTTTCTCGAGAAAGTTTCTCACCAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-1211s1c1
Sequence:CCGGCCTTCAATTATTCCAACTCATCTCGAGATGAGTTGGAATAATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024106.1-1595s1c1
Sequence:CCGGCCCAGAAACCATACACCTGTACTCGAGTACAGGTGTATGGTTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-514s21c2
Sequence:CCGGCAGATCATCAAACCCAGTCTACTCGAGTAGACTGGGTTTGATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-1211s21c2
Sequence:CCGGCCTTCAATTATTCCAACTCATCTCGAGATGAGTTGGAATAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-833s21c2
Sequence:CCGGCCTCTACTGGTGAGAAACTTTCTCGAGAAAGTTTCTCACCAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-1383s21c2
Sequence:CCGGCCTTACATCCTCACGCCTTATCTCGAGATAAGGCGTGAGGATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024106
VALIDATED
ZNF426 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 426
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-1383s1c1
Sequence:CCGGCCTTACATCCTCACGCCTTATCTCGAGATAAGGCGTGAGGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-833s1c1
Sequence:CCGGCCTCTACTGGTGAGAAACTTTCTCGAGAAAGTTTCTCACCAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-1211s1c1
Sequence:CCGGCCTTCAATTATTCCAACTCATCTCGAGATGAGTTGGAATAATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024106.1-1595s1c1
Sequence:CCGGCCCAGAAACCATACACCTGTACTCGAGTACAGGTGTATGGTTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-514s21c2
Sequence:CCGGCAGATCATCAAACCCAGTCTACTCGAGTAGACTGGGTTTGATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-1211s21c2
Sequence:CCGGCCTTCAATTATTCCAACTCATCTCGAGATGAGTTGGAATAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-833s21c2
Sequence:CCGGCCTCTACTGGTGAGAAACTTTCTCGAGAAAGTTTCTCACCAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-1383s21c2
Sequence:CCGGCCTTACATCCTCACGCCTTATCTCGAGATAAGGCGTGAGGATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024106
VALIDATED
ZNF426 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 426
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-1383s1c1
Sequence:CCGGCCTTACATCCTCACGCCTTATCTCGAGATAAGGCGTGAGGATGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-833s1c1
Sequence:CCGGCCTCTACTGGTGAGAAACTTTCTCGAGAAAGTTTCTCACCAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024106.1-1211s1c1
Sequence:CCGGCCTTCAATTATTCCAACTCATCTCGAGATGAGTTGGAATAATTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024106.1-1595s1c1
Sequence:CCGGCCCAGAAACCATACACCTGTACTCGAGTACAGGTGTATGGTTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-514s21c2
Sequence:CCGGCAGATCATCAAACCCAGTCTACTCGAGTAGACTGGGTTTGATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-1211s21c2
Sequence:CCGGCCTTCAATTATTCCAACTCATCTCGAGATGAGTTGGAATAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-833s21c2
Sequence:CCGGCCTCTACTGGTGAGAAACTTTCTCGAGAAAGTTTCTCACCAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024106.1-1383s21c2
Sequence:CCGGCCTTACATCCTCACGCCTTATCTCGAGATAAGGCGTGAGGATGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks