EMAIL THIS PAGE TO A FRIEND

ZNF428

zinc finger protein 428

Synonyms: C19orf37 Zfp428
UniProtKB ID: Q96B54, O95054, Q6X3Y3
Gene ID:
dog(611184) zinc finger protein 428
domestic guinea pig(100728308) zinc finger protein 428
naked mole-rat(101704934) zinc finger protein 428
cow(540173) zinc finger protein 428
sheep(101107303) zinc finger protein 428
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182498 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094731 predicted 498
2 SASI_Hs01_00094733 predicted 1306
3 SASI_Hs01_00094735 predicted 1336
4 SASI_Hs02_00370545 predicted 1095
5 SASI_Hs01_00094736 predicted 507
6 SASI_Hs01_00094737 predicted 1288
7 SASI_Hs01_00094738 predicted 508
8 SASI_Hs01_00094739 predicted 599
9 SASI_Hs01_00094740 predicted 1299
10 SASI_Hs02_00370546 predicted 1101
11 SASI_Hs01_00094732 predicted 1350
12 SASI_Hs01_00094734 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182498
VALIDATED
ZNF428 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 428
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-507s21c1
Sequence:CCGGCCGAGCATTCCTCTGATTCAGCTCGAGCTGAATCAGAGGAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-589s21c1
Sequence:CCGGGACCACTGACGATCCTGAATACTCGAGTATTCAGGATCGTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-611s21c1
Sequence:CCGGGATCCTGGCTACAAGGTGAAGCTCGAGCTTCACCTTGTAGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182498.2-905s21c1
Sequence:CCGGACCTACCACTGTACGGAATGTCTCGAGACATTCCGTACAGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-1093s21c1
Sequence:CCGGTGCCGGTCTGTGTTGTCTTAGCTCGAGCTAAGACAACACAGACCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182498.2-508s1c1
Sequence:CCGGCGAGCATTCCTCTGATTCAGACTCGAGTCTGAATCAGAGGAATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182498.2-521s1c1
Sequence:CCGGGATTCAGAATACACTCTCTCACTCGAGTGAGAGAGTGTATTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182498
VALIDATED
ZNF428 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 428
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-507s21c1
Sequence:CCGGCCGAGCATTCCTCTGATTCAGCTCGAGCTGAATCAGAGGAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-589s21c1
Sequence:CCGGGACCACTGACGATCCTGAATACTCGAGTATTCAGGATCGTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-611s21c1
Sequence:CCGGGATCCTGGCTACAAGGTGAAGCTCGAGCTTCACCTTGTAGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182498.2-905s21c1
Sequence:CCGGACCTACCACTGTACGGAATGTCTCGAGACATTCCGTACAGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-1093s21c1
Sequence:CCGGTGCCGGTCTGTGTTGTCTTAGCTCGAGCTAAGACAACACAGACCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182498.2-508s1c1
Sequence:CCGGCGAGCATTCCTCTGATTCAGACTCGAGTCTGAATCAGAGGAATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182498.2-521s1c1
Sequence:CCGGGATTCAGAATACACTCTCTCACTCGAGTGAGAGAGTGTATTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182498
VALIDATED
ZNF428 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 428
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-507s21c1
Sequence:CCGGCCGAGCATTCCTCTGATTCAGCTCGAGCTGAATCAGAGGAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-589s21c1
Sequence:CCGGGACCACTGACGATCCTGAATACTCGAGTATTCAGGATCGTCAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-611s21c1
Sequence:CCGGGATCCTGGCTACAAGGTGAAGCTCGAGCTTCACCTTGTAGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182498.2-905s21c1
Sequence:CCGGACCTACCACTGTACGGAATGTCTCGAGACATTCCGTACAGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182498.2-1093s21c1
Sequence:CCGGTGCCGGTCTGTGTTGTCTTAGCTCGAGCTAAGACAACACAGACCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182498.2-508s1c1
Sequence:CCGGCGAGCATTCCTCTGATTCAGACTCGAGTCTGAATCAGAGGAATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182498.2-521s1c1
Sequence:CCGGGATTCAGAATACACTCTCTCACTCGAGTGAGAGAGTGTATTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks