EMAIL THIS PAGE TO A FRIEND

ZNF429

zinc finger protein 429

UniProtKB ID: Q86V71, A6NLV7, Q9BZE6
Gene ID:
dog(484324) zinc finger protein 92-like
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001415 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001415 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303753 predicted 923
2 SASI_Hs01_00166908 predicted 322
3 SASI_Hs01_00166914 predicted 1616
4 SASI_Hs01_00166909 predicted 508
5 SASI_Hs01_00166915 predicted 1611
6 SASI_Hs01_00166917 predicted 1274
7 SASI_Hs01_00166911 predicted 1014
8 SASI_Hs02_00303754 predicted 1270
9 SASI_Hs01_00166912 predicted 729
10 SASI_Hs01_00166916 predicted 1865
11 SASI_Hs01_00166910 predicted 1001
12 SASI_Hs01_00166913 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001415
ZNF429 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 429
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1280s21c1
Sequence:CCGGTTCAAGACTTACTCGACATAACTCGAGTTATGTCGAGTAAGTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1943s21c1
Sequence:CCGGTAATCGGTCCTCAAGACTTACCTCGAGGTAAGTCTTGAGGACCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1018s21c1
Sequence:CCGGTTAGCATATCCTCAACCTTTACTCGAGTAAAGGTTGAGGATATGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-509s21c1
Sequence:CCGGGCTATACAAAGGAGGTTATAACTCGAGTTATAACCTCCTTTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-2027s21c1
Sequence:CCGGTACCCGGTCTTCAAGACTTACCTCGAGGTAAGTCTTGAAGACCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001415
ZNF429 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 429
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1280s21c1
Sequence:CCGGTTCAAGACTTACTCGACATAACTCGAGTTATGTCGAGTAAGTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1943s21c1
Sequence:CCGGTAATCGGTCCTCAAGACTTACCTCGAGGTAAGTCTTGAGGACCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1018s21c1
Sequence:CCGGTTAGCATATCCTCAACCTTTACTCGAGTAAAGGTTGAGGATATGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-509s21c1
Sequence:CCGGGCTATACAAAGGAGGTTATAACTCGAGTTATAACCTCCTTTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-2027s21c1
Sequence:CCGGTACCCGGTCTTCAAGACTTACCTCGAGGTAAGTCTTGAAGACCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001415
ZNF429 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 429
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1280s21c1
Sequence:CCGGTTCAAGACTTACTCGACATAACTCGAGTTATGTCGAGTAAGTCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1943s21c1
Sequence:CCGGTAATCGGTCCTCAAGACTTACCTCGAGGTAAGTCTTGAGGACCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-1018s21c1
Sequence:CCGGTTAGCATATCCTCAACCTTTACTCGAGTAAAGGTTGAGGATATGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-509s21c1
Sequence:CCGGGCTATACAAAGGAGGTTATAACTCGAGTTATAACCTCCTTTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001415.2-2027s21c1
Sequence:CCGGTACCCGGTCTTCAAGACTTACCTCGAGGTAAGTCTTGAAGACCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks