EMAIL THIS PAGE TO A FRIEND

ZNF430

zinc finger protein 430

Species: Human ZNF430(80264)
UniProtKB ID: Q9H8G1, Q86V70
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025189 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117431 MISSION® esiRNA esiRNA human ZNF738 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025189 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229670 predicted 1631
2 SASI_Hs01_00229672 predicted 608
3 SASI_Hs01_00229669 predicted 615
4 SASI_Hs01_00229674 predicted 626
5 SASI_Hs01_00229671 predicted 1623
6 SASI_Hs01_00229675 predicted 1633
7 SASI_Hs01_00229676 predicted 484
8 SASI_Hs01_00229677 predicted 1838
9 SASI_Hs01_00229673 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025189
ZNF430 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 430
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-579s1c1
Sequence:CCGGCTGCACAAAGAATGTTATGATCTCGAGATCATAACATTCTTTGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-390s1c1
Sequence:CCGGCCCTGGAATATGAAGAGACATCTCGAGATGTCTCTTCATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-1655s1c1
Sequence:CCGGCCTAGAATGTGATAAAGCCTTCTCGAGAAGGCTTTATCACATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-1679s1c1
Sequence:CCGGCCAGTCTTCAACTCTTACTAACTCGAGTTAGTAAGAGTTGAAGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-428s1c1
Sequence:CCGGCCCAGTTACATATTCTCATTTCTCGAGAAATGAGAATATGTAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-1523s21c1
Sequence:CCGGACTTACTGCACATAAGGTAATCTCGAGATTACCTTATGTGCAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025189.2-1942s21c1
Sequence:CCGGCTTACCAGACATAAGATAATTCTCGAGAATTATCTTATGTCTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-619s21c1
Sequence:CCGGCAACTACCCAGAGTGAAATATCTCGAGATATTTCACTCTGGGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-322s21c1
Sequence:CCGGTGGTCTTCTTGGCAGGTATTGCTCGAGCAATACCTGCCAAGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025189.2-1836s21c1
Sequence:CCGGAGCCTCTAACCCGTCCTGAATCTCGAGATTCAGGACGGGTTAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-762s21c1
Sequence:CCGGTTACACCTAACTCAACATAAACTCGAGTTTATGTTGAGTTAGGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025189
ZNF430 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 430
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-579s1c1
Sequence:CCGGCTGCACAAAGAATGTTATGATCTCGAGATCATAACATTCTTTGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-390s1c1
Sequence:CCGGCCCTGGAATATGAAGAGACATCTCGAGATGTCTCTTCATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-1655s1c1
Sequence:CCGGCCTAGAATGTGATAAAGCCTTCTCGAGAAGGCTTTATCACATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-1679s1c1
Sequence:CCGGCCAGTCTTCAACTCTTACTAACTCGAGTTAGTAAGAGTTGAAGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-428s1c1
Sequence:CCGGCCCAGTTACATATTCTCATTTCTCGAGAAATGAGAATATGTAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-1523s21c1
Sequence:CCGGACTTACTGCACATAAGGTAATCTCGAGATTACCTTATGTGCAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025189.2-1942s21c1
Sequence:CCGGCTTACCAGACATAAGATAATTCTCGAGAATTATCTTATGTCTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-619s21c1
Sequence:CCGGCAACTACCCAGAGTGAAATATCTCGAGATATTTCACTCTGGGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-322s21c1
Sequence:CCGGTGGTCTTCTTGGCAGGTATTGCTCGAGCAATACCTGCCAAGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025189.2-1836s21c1
Sequence:CCGGAGCCTCTAACCCGTCCTGAATCTCGAGATTCAGGACGGGTTAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-762s21c1
Sequence:CCGGTTACACCTAACTCAACATAAACTCGAGTTTATGTTGAGTTAGGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025189
ZNF430 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 430
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-579s1c1
Sequence:CCGGCTGCACAAAGAATGTTATGATCTCGAGATCATAACATTCTTTGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-390s1c1
Sequence:CCGGCCCTGGAATATGAAGAGACATCTCGAGATGTCTCTTCATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-1655s1c1
Sequence:CCGGCCTAGAATGTGATAAAGCCTTCTCGAGAAGGCTTTATCACATTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-1679s1c1
Sequence:CCGGCCAGTCTTCAACTCTTACTAACTCGAGTTAGTAAGAGTTGAAGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025189.2-428s1c1
Sequence:CCGGCCCAGTTACATATTCTCATTTCTCGAGAAATGAGAATATGTAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-1523s21c1
Sequence:CCGGACTTACTGCACATAAGGTAATCTCGAGATTACCTTATGTGCAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025189.2-1942s21c1
Sequence:CCGGCTTACCAGACATAAGATAATTCTCGAGAATTATCTTATGTCTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-619s21c1
Sequence:CCGGCAACTACCCAGAGTGAAATATCTCGAGATATTTCACTCTGGGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-322s21c1
Sequence:CCGGTGGTCTTCTTGGCAGGTATTGCTCGAGCAATACCTGCCAAGAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025189.2-1836s21c1
Sequence:CCGGAGCCTCTAACCCGTCCTGAATCTCGAGATTCAGGACGGGTTAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025189.2-762s21c1
Sequence:CCGGTTACACCTAACTCAACATAAACTCGAGTTTATGTTGAGTTAGGTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks