EMAIL THIS PAGE TO A FRIEND

ZNF431

zinc finger protein 431

Species: Human ZNF431(170959)
UniProtKB ID: Q8TF32, A8KAK7, Q8IWC4
Gene ID:
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133473 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363178 predicted 1075
2 SASI_Hs01_00046759 predicted 1725
3 SASI_Hs01_00046760 predicted 1730
4 SASI_Hs01_00046758 predicted 107
5 SASI_Hs01_00046761 predicted 104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133473
ZNF431 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 431
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133473.2-1797s21c1
Sequence:CCGGCCAGTCCTCAAACCTTATTAACTCGAGTTAATAAGGTTTGAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133473.2-613s21c1
Sequence:CCGGGTGCACAAAGAAGGTTATAATCTCGAGATTATAACCTTCTTTGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-542s1c1
Sequence:CCGGCCGCAAGTGTAGATGAGTATACTCGAGTATACTCATCTACACTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-1419s1c1
Sequence:CCGGCCCACAACTTACTGCACATAACTCGAGTTATGTGCAGTAAGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-414s1c1
Sequence:CCGGCCCAGCTATGTGTTCTTATTTCTCGAGAAATAAGAACACATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-157s1c1
Sequence:CCGGGCTGAGAGGAATCTTCTAGTTCTCGAGAACTAGAAGATTCCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-1724s1c1
Sequence:CCGGGTGAAGAATGTGACAATACATCTCGAGATGTATTGTCACATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133473
ZNF431 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 431
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133473.2-1797s21c1
Sequence:CCGGCCAGTCCTCAAACCTTATTAACTCGAGTTAATAAGGTTTGAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133473.2-613s21c1
Sequence:CCGGGTGCACAAAGAAGGTTATAATCTCGAGATTATAACCTTCTTTGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-542s1c1
Sequence:CCGGCCGCAAGTGTAGATGAGTATACTCGAGTATACTCATCTACACTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-1419s1c1
Sequence:CCGGCCCACAACTTACTGCACATAACTCGAGTTATGTGCAGTAAGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-414s1c1
Sequence:CCGGCCCAGCTATGTGTTCTTATTTCTCGAGAAATAAGAACACATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-157s1c1
Sequence:CCGGGCTGAGAGGAATCTTCTAGTTCTCGAGAACTAGAAGATTCCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-1724s1c1
Sequence:CCGGGTGAAGAATGTGACAATACATCTCGAGATGTATTGTCACATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133473
ZNF431 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 431
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133473.2-1797s21c1
Sequence:CCGGCCAGTCCTCAAACCTTATTAACTCGAGTTAATAAGGTTTGAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133473.2-613s21c1
Sequence:CCGGGTGCACAAAGAAGGTTATAATCTCGAGATTATAACCTTCTTTGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-542s1c1
Sequence:CCGGCCGCAAGTGTAGATGAGTATACTCGAGTATACTCATCTACACTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-1419s1c1
Sequence:CCGGCCCACAACTTACTGCACATAACTCGAGTTATGTGCAGTAAGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-414s1c1
Sequence:CCGGCCCAGCTATGTGTTCTTATTTCTCGAGAAATAAGAACACATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-157s1c1
Sequence:CCGGGCTGAGAGGAATCTTCTAGTTCTCGAGAACTAGAAGATTCCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133473.1-1724s1c1
Sequence:CCGGGTGAAGAATGTGACAATACATCTCGAGATGTATTGTCACATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks