EMAIL THIS PAGE TO A FRIEND

ZNF432

zinc finger protein 432

UniProtKB ID: O94892
Gene ID:
chicken(420365) zinc finger protein 432
domestic cat(101083984) zinc finger protein 432
Horse(100065138) zinc finger protein 432
dog(100685146) zinc finger protein 432
cow(539365) zinc finger protein 432
sheep(101103836) zinc finger protein 432
domestic guinea pig(101788073) zinc finger protein 432
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014650 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106626 predicted 551
2 SASI_Hs01_00106627 predicted 1007
3 SASI_Hs01_00106628 predicted 2148
4 SASI_Hs01_00106629 predicted 872
5 SASI_Hs01_00106630 predicted 1816
6 SASI_Hs01_00106631 predicted 977
7 SASI_Hs01_00106632 predicted 1880
8 SASI_Hs01_00106633 predicted 1589
9 SASI_Hs01_00106634 predicted 2124
10 SASI_Hs01_00106635 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014650
ZNF432 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 432
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-878s1c1
Sequence:CCGGGCACTAAATCCCAAGTCAGTACTCGAGTACTGACTTGGGATTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-1549s1c1
Sequence:CCGGCCCAGGAAGAGTAATCTTATTCTCGAGAATAAGATTACTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-1885s1c1
Sequence:CCGGGCCTTTAAGAGCAATCTTGTTCTCGAGAACAAGATTGCTCTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014650.2-2318s1c1
Sequence:CCGGGCCTTGTACAACATCAGAGATCTCGAGATCTCTGATGTTGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-444s1c1
Sequence:CCGGCAACCTGCTATCAATGGGTTACTCGAGTAACCCATTGATAGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-2136s21c1
Sequence:CCGGCACTATGAAGAGCCGTCTAATCTCGAGATTAGACGGCTCTTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014650.2-2408s21c1
Sequence:CCGGCTAGGATGAATGCTATCAATGCTCGAGCATTGATAGCATTCATCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-1396s21c1
Sequence:CCGGGTCATCATACATCAACGAAATCTCGAGATTTCGTTGATGTATGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-446s21c1
Sequence:CCGGACCTGCTATCAATGGGTTATCCTCGAGGATAACCCATTGATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-1130s21c1
Sequence:CCGGCTATGAAGAGCCGTCTGATTGCTCGAGCAATCAGACGGCTCTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014650
ZNF432 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 432
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-878s1c1
Sequence:CCGGGCACTAAATCCCAAGTCAGTACTCGAGTACTGACTTGGGATTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-1549s1c1
Sequence:CCGGCCCAGGAAGAGTAATCTTATTCTCGAGAATAAGATTACTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-1885s1c1
Sequence:CCGGGCCTTTAAGAGCAATCTTGTTCTCGAGAACAAGATTGCTCTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014650.2-2318s1c1
Sequence:CCGGGCCTTGTACAACATCAGAGATCTCGAGATCTCTGATGTTGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-444s1c1
Sequence:CCGGCAACCTGCTATCAATGGGTTACTCGAGTAACCCATTGATAGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-2136s21c1
Sequence:CCGGCACTATGAAGAGCCGTCTAATCTCGAGATTAGACGGCTCTTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014650.2-2408s21c1
Sequence:CCGGCTAGGATGAATGCTATCAATGCTCGAGCATTGATAGCATTCATCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-1396s21c1
Sequence:CCGGGTCATCATACATCAACGAAATCTCGAGATTTCGTTGATGTATGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-446s21c1
Sequence:CCGGACCTGCTATCAATGGGTTATCCTCGAGGATAACCCATTGATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-1130s21c1
Sequence:CCGGCTATGAAGAGCCGTCTGATTGCTCGAGCAATCAGACGGCTCTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014650
ZNF432 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 432
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-878s1c1
Sequence:CCGGGCACTAAATCCCAAGTCAGTACTCGAGTACTGACTTGGGATTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-1549s1c1
Sequence:CCGGCCCAGGAAGAGTAATCTTATTCTCGAGAATAAGATTACTCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-1885s1c1
Sequence:CCGGGCCTTTAAGAGCAATCTTGTTCTCGAGAACAAGATTGCTCTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014650.2-2318s1c1
Sequence:CCGGGCCTTGTACAACATCAGAGATCTCGAGATCTCTGATGTTGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014650.2-444s1c1
Sequence:CCGGCAACCTGCTATCAATGGGTTACTCGAGTAACCCATTGATAGCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-2136s21c1
Sequence:CCGGCACTATGAAGAGCCGTCTAATCTCGAGATTAGACGGCTCTTCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014650.2-2408s21c1
Sequence:CCGGCTAGGATGAATGCTATCAATGCTCGAGCATTGATAGCATTCATCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-1396s21c1
Sequence:CCGGGTCATCATACATCAACGAAATCTCGAGATTTCGTTGATGTATGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-446s21c1
Sequence:CCGGACCTGCTATCAATGGGTTATCCTCGAGGATAACCCATTGATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014650.2-1130s21c1
Sequence:CCGGCTATGAAGAGCCGTCTGATTGCTCGAGCAATCAGACGGCTCTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks