EMAIL THIS PAGE TO A FRIEND

ZNF433

zinc finger protein 433

Species: Human ZNF433(163059)
UniProtKB ID: Q8N7K0, Q86VX3
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080411 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152602 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001561 MISSION® esiRNA esiRNA targeting human ZNF433 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080411 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314586 predicted 1626
2 SASI_Hs02_00314587 predicted 681
3 SASI_Hs02_00314588 predicted 752
4 SASI_Hs02_00314589 predicted 675
5 SASI_Hs02_00314590 predicted 614
6 SASI_Hs02_00314591 predicted 1205
7 SASI_Hs02_00314592 predicted 324
8 SASI_Hs02_00314593 predicted 257
9 SASI_Hs02_00314594 predicted 1597
10 SASI_Hs02_00314595 predicted 1187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080411
ZNF433 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 433
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000435258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080411.1-970s21c1
Sequence:CCGGACATGCCTTCATGCTCATAAACTCGAGTTTATGAGCATGAAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080411.1-1721s21c1
Sequence:CCGGGTTCGAGCTCCTTTCGATATCCTCGAGGATATCGAAAGGAGCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080411
ZNF433 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 433
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000435258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080411.1-970s21c1
Sequence:CCGGACATGCCTTCATGCTCATAAACTCGAGTTTATGAGCATGAAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080411.1-1721s21c1
Sequence:CCGGGTTCGAGCTCCTTTCGATATCCTCGAGGATATCGAAAGGAGCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080411
ZNF433 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 433
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000435258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080411.1-970s21c1
Sequence:CCGGACATGCCTTCATGCTCATAAACTCGAGTTTATGAGCATGAAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080411.1-1721s21c1
Sequence:CCGGGTTCGAGCTCCTTTCGATATCCTCGAGGATATCGAAAGGAGCTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152602
ZNF433 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 433
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1599s1c1
Sequence:CCGGGCCGTATGAATGTAAGGGTTACTCGAGTAACCCTTACATTCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-510s1c1
Sequence:CCGGCAGTGCTCATTCATCTCTTAACTCGAGTTAAGAGATGAATGAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1471s1c1
Sequence:CCGGGCCTCACTCCTTCAAACACATCTCGAGATGTGTTTGAAGGAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-635s1c1
Sequence:CCGGCCTCTGTTCAGACACATGAAACTCGAGTTTCATGTGTCTGAACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1303s1c1
Sequence:CCGGCCCAGTTCACTTCAAACACATCTCGAGATGTGTTTGAAGTGAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152602
ZNF433 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 433
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1599s1c1
Sequence:CCGGGCCGTATGAATGTAAGGGTTACTCGAGTAACCCTTACATTCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-510s1c1
Sequence:CCGGCAGTGCTCATTCATCTCTTAACTCGAGTTAAGAGATGAATGAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1471s1c1
Sequence:CCGGGCCTCACTCCTTCAAACACATCTCGAGATGTGTTTGAAGGAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-635s1c1
Sequence:CCGGCCTCTGTTCAGACACATGAAACTCGAGTTTCATGTGTCTGAACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1303s1c1
Sequence:CCGGCCCAGTTCACTTCAAACACATCTCGAGATGTGTTTGAAGTGAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152602
ZNF433 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 433
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1599s1c1
Sequence:CCGGGCCGTATGAATGTAAGGGTTACTCGAGTAACCCTTACATTCATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-510s1c1
Sequence:CCGGCAGTGCTCATTCATCTCTTAACTCGAGTTAAGAGATGAATGAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1471s1c1
Sequence:CCGGGCCTCACTCCTTCAAACACATCTCGAGATGTGTTTGAAGGAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-635s1c1
Sequence:CCGGCCTCTGTTCAGACACATGAAACTCGAGTTTCATGTGTCTGAACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152602.1-1303s1c1
Sequence:CCGGCCCAGTTCACTTCAAACACATCTCGAGATGTGTTTGAAGTGAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks