EMAIL THIS PAGE TO A FRIEND

ZNF436

zinc finger protein 436

Synonyms: ZNF Zfp46
UniProtKB ID: Q9C0F3, Q658I9
Gene ID:
dog(100684593) zinc finger protein 436
Horse(100057918) zinc finger protein 436
domestic cat(101097572) zinc finger protein 436
domestic guinea pig(101788483) zinc finger protein 436
naked mole-rat(101709161) zinc finger protein 436
cow(525080) zinc finger protein 436
sheep(101121324) zinc finger protein 436
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030634 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086241 MISSION® esiRNA esiRNA human ZNF436 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077195 Rosetta Predictions human pricing
NM_030634 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312154 predicted 1424
2 SASI_Hs02_00312155 predicted 1967
3 SASI_Hs02_00312156 predicted 1749
4 SASI_Hs02_00312157 predicted 1162
5 SASI_Hs02_00312158 predicted 785
6 SASI_Hs02_00312159 predicted 747
7 SASI_Hs02_00312160 predicted 997
8 SASI_Hs02_00312161 predicted 1264
9 SASI_Hs02_00312162 predicted 1427
10 SASI_Hs02_00312163 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140507 predicted 1245
2 SASI_Hs01_00140508 predicted 1793
3 SASI_Hs01_00140509 predicted 1576
4 SASI_Hs01_00140510 predicted 987
5 SASI_Hs01_00140513 predicted 608
6 SASI_Hs01_00140514 predicted 571
7 SASI_Hs01_00140515 predicted 819
8 SASI_Hs01_00140516 predicted 1085
9 SASI_Hs02_00358208 predicted 1251
10 SASI_Hs02_00358209 predicted 558
11 SASI_Hs01_00140511 predicted 491
12 SASI_Hs01_00140512 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030634
ZNF436 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 436
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-499s1c1
Sequence:CCGGCGGGATGTTATGCAGGAGAATCTCGAGATTCTCCTGCATAACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-574s1c1
Sequence:CCGGCCCAAGCAAGAGATTAGTGAACTCGAGTTCACTAATCTCTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-1748s1c1
Sequence:CCGGGCAGGAGCTCAGCTCTTATTACTCGAGTAATAAGAGCTGAGCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-649s1c1
Sequence:CCGGCCTGAAAGTGAAGAGGGCTTTCTCGAGAAAGCCCTCTTCACTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-787s1c1
Sequence:CCGGCGCTATCATATATGTTCTCATCTCGAGATGAGAACATATATGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-553s21c1
Sequence:CCGGAGGAGTGAGAACGAGGTAAATCTCGAGATTTACCTCGTTCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-823s21c1
Sequence:GTACCGGAGTCAGATCTCAGACCTTAATCTCGAGATTAAGGTCTGAGATCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-779s21c1
Sequence:CCGGCAGGCATCCGCTATCATATATCTCGAGATATATGATAGCGGATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-908s21c1
Sequence:CCGGGTCGCAGCTCACACCTTATTCCTCGAGGAATAAGGTGTGAGCTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030634.2-1896s21c1
Sequence:CCGGAGTTGTGGGCCACGATTTAAACTCGAGTTTAAATCGTGGCCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030634
ZNF436 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 436
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-499s1c1
Sequence:CCGGCGGGATGTTATGCAGGAGAATCTCGAGATTCTCCTGCATAACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-574s1c1
Sequence:CCGGCCCAAGCAAGAGATTAGTGAACTCGAGTTCACTAATCTCTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-1748s1c1
Sequence:CCGGGCAGGAGCTCAGCTCTTATTACTCGAGTAATAAGAGCTGAGCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-649s1c1
Sequence:CCGGCCTGAAAGTGAAGAGGGCTTTCTCGAGAAAGCCCTCTTCACTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-787s1c1
Sequence:CCGGCGCTATCATATATGTTCTCATCTCGAGATGAGAACATATATGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-553s21c1
Sequence:CCGGAGGAGTGAGAACGAGGTAAATCTCGAGATTTACCTCGTTCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-823s21c1
Sequence:GTACCGGAGTCAGATCTCAGACCTTAATCTCGAGATTAAGGTCTGAGATCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-779s21c1
Sequence:CCGGCAGGCATCCGCTATCATATATCTCGAGATATATGATAGCGGATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-908s21c1
Sequence:CCGGGTCGCAGCTCACACCTTATTCCTCGAGGAATAAGGTGTGAGCTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030634.2-1896s21c1
Sequence:CCGGAGTTGTGGGCCACGATTTAAACTCGAGTTTAAATCGTGGCCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030634
ZNF436 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 436
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-499s1c1
Sequence:CCGGCGGGATGTTATGCAGGAGAATCTCGAGATTCTCCTGCATAACATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-574s1c1
Sequence:CCGGCCCAAGCAAGAGATTAGTGAACTCGAGTTCACTAATCTCTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-1748s1c1
Sequence:CCGGGCAGGAGCTCAGCTCTTATTACTCGAGTAATAAGAGCTGAGCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-649s1c1
Sequence:CCGGCCTGAAAGTGAAGAGGGCTTTCTCGAGAAAGCCCTCTTCACTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030634.1-787s1c1
Sequence:CCGGCGCTATCATATATGTTCTCATCTCGAGATGAGAACATATATGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-553s21c1
Sequence:CCGGAGGAGTGAGAACGAGGTAAATCTCGAGATTTACCTCGTTCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-823s21c1
Sequence:GTACCGGAGTCAGATCTCAGACCTTAATCTCGAGATTAAGGTCTGAGATCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-779s21c1
Sequence:CCGGCAGGCATCCGCTATCATATATCTCGAGATATATGATAGCGGATGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030634.2-908s21c1
Sequence:CCGGGTCGCAGCTCACACCTTATTCCTCGAGGAATAAGGTGTGAGCTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030634.2-1896s21c1
Sequence:CCGGAGTTGTGGGCCACGATTTAAACTCGAGTTTAAATCGTGGCCCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks