EMAIL THIS PAGE TO A FRIEND

ZNF438

zinc finger protein 438

Synonyms: bA330O11.1
UniProtKB ID: Q7Z4V0, A2A3J4, A8K9L5, Q5T426, Q658Q4, Q6ZN65
Gene ID:
cow(510512) zinc finger protein 438
sheep(101119238) zinc finger protein 438
naked mole-rat(101714455) zinc finger protein 438
domestic guinea pig(100729167) zinc finger protein 438
Zebrafish(798757) zinc finger protein 438
chicken(420474) zinc finger protein 438
domestic cat(101098964) zinc finger protein 438
dog(487086) zinc finger protein 438
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182755 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091261 MISSION® esiRNA esiRNA human ZNF438 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182755 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074083 predicted 1922
2 SASI_Hs02_00370911 predicted 2481
3 SASI_Hs01_00074085 predicted 1624
4 SASI_Hs01_00074086 predicted 2668
5 SASI_Hs01_00074087 predicted 2903
6 SASI_Hs01_00074089 predicted 2910
7 SASI_Hs01_00074090 predicted 1640
8 SASI_Hs02_00370912 predicted 929
9 SASI_Hs01_00074091 predicted 1981
10 SASI_Hs01_00074092 predicted 746
11 SASI_Hs01_00074084 predicted 1255
12 SASI_Hs01_00074088 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182755
VALIDATED
ZNF438 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 438
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-2998s21c1
Sequence:CCGGGCTTAGTCACAAAGATCAAACCTCGAGGTTTGATCTTTGTGACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182755.2-1848s21c1
Sequence:CCGGTAATTCACTCACTCCTAAATACTCGAGTATTTAGGAGTGAGTGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-2970s21c1
Sequence:CCGGCCTTCAGAGCTTCGTGCTTTACTCGAGTAAAGCACGAAGCTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-3087s21c1
Sequence:CCGGATAAGCTCTCGAAGCATATTTCTCGAGAAATATGCTTCGAGAGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-2537s1c1
Sequence:CCGGGCGTGGAAATGCTCATGGAAACTCGAGTTTCCATGAGCATTTCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-1048s1c1
Sequence:CCGGGCACACTTTGTAAGCAAGATACTCGAGTATCTTGCTTACAAAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182755.1-1928s1c1
Sequence:CCGGGCCCTTACAGTTGTCGGATTTCTCGAGAAATCCGACAACTGTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-1212s1c1
Sequence:CCGGCCCACCCTACTCAAGAATGAACTCGAGTTCATTCTTGAGTAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182755.1-642s1c1
Sequence:CCGGGCCAATTCAGAAACCCAGAATCTCGAGATTCTGGGTTTCTGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182755
VALIDATED
ZNF438 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 438
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-2998s21c1
Sequence:CCGGGCTTAGTCACAAAGATCAAACCTCGAGGTTTGATCTTTGTGACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182755.2-1848s21c1
Sequence:CCGGTAATTCACTCACTCCTAAATACTCGAGTATTTAGGAGTGAGTGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-2970s21c1
Sequence:CCGGCCTTCAGAGCTTCGTGCTTTACTCGAGTAAAGCACGAAGCTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-3087s21c1
Sequence:CCGGATAAGCTCTCGAAGCATATTTCTCGAGAAATATGCTTCGAGAGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-2537s1c1
Sequence:CCGGGCGTGGAAATGCTCATGGAAACTCGAGTTTCCATGAGCATTTCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-1048s1c1
Sequence:CCGGGCACACTTTGTAAGCAAGATACTCGAGTATCTTGCTTACAAAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182755.1-1928s1c1
Sequence:CCGGGCCCTTACAGTTGTCGGATTTCTCGAGAAATCCGACAACTGTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-1212s1c1
Sequence:CCGGCCCACCCTACTCAAGAATGAACTCGAGTTCATTCTTGAGTAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182755.1-642s1c1
Sequence:CCGGGCCAATTCAGAAACCCAGAATCTCGAGATTCTGGGTTTCTGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182755
VALIDATED
ZNF438 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 438
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-2998s21c1
Sequence:CCGGGCTTAGTCACAAAGATCAAACCTCGAGGTTTGATCTTTGTGACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182755.2-1848s21c1
Sequence:CCGGTAATTCACTCACTCCTAAATACTCGAGTATTTAGGAGTGAGTGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-2970s21c1
Sequence:CCGGCCTTCAGAGCTTCGTGCTTTACTCGAGTAAAGCACGAAGCTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182755.2-3087s21c1
Sequence:CCGGATAAGCTCTCGAAGCATATTTCTCGAGAAATATGCTTCGAGAGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-2537s1c1
Sequence:CCGGGCGTGGAAATGCTCATGGAAACTCGAGTTTCCATGAGCATTTCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-1048s1c1
Sequence:CCGGGCACACTTTGTAAGCAAGATACTCGAGTATCTTGCTTACAAAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_182755.1-1928s1c1
Sequence:CCGGGCCCTTACAGTTGTCGGATTTCTCGAGAAATCCGACAACTGTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_182755.1-1212s1c1
Sequence:CCGGCCCACCCTACTCAAGAATGAACTCGAGTTCATTCTTGAGTAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182755.1-642s1c1
Sequence:CCGGGCCAATTCAGAAACCCAGAATCTCGAGATTCTGGGTTTCTGAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks