EMAIL THIS PAGE TO A FRIEND

ZNF439

zinc finger protein 439

Species: Human ZNF439(90594)
UniProtKB ID: Q8NDP4, Q8IYZ7, Q96SU1
Gene ID:
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152262 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107251 MISSION® esiRNA esiRNA human ZNF700 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152262 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165358 predicted 1719
2 SASI_Hs01_00165359 predicted 500
3 SASI_Hs01_00165360 predicted 1629
4 SASI_Hs01_00165361 predicted 1543
5 SASI_Hs01_00165362 predicted 146
6 SASI_Hs01_00165363 predicted 151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152262
ZNF439 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 439
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-568s1c1
Sequence:CCGGGCATGTGAATGTCAGGAATATCTCGAGATATTCCTGACATTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1561s1c1
Sequence:CCGGGTCCAGAACTTTCGATTTCATCTCGAGATGAAATCGAAAGTTCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1551s1c1
Sequence:CCGGCTTCAGATATGTCCAGAACTTCTCGAGAAGTTCTGGACATATCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1225s1c1
Sequence:CCGGGCCAAGTCATTTCAAAGACATCTCGAGATGTCTTTGAAATGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-234s1c1
Sequence:CCGGGCTGGATATTTCCCAGAAGAACTCGAGTTCTTCTGGGAAATATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152262.2-2053s21c1
Sequence:CCGGATGCAAACAAGCATTCAATTACTCGAGTAATTGAATGCTTGTTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152262.2-282s21c1
Sequence:CCGGTTCTGGAACCTGACCTCTATACTCGAGTATAGAGGTCAGGTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152262
ZNF439 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 439
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-568s1c1
Sequence:CCGGGCATGTGAATGTCAGGAATATCTCGAGATATTCCTGACATTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1561s1c1
Sequence:CCGGGTCCAGAACTTTCGATTTCATCTCGAGATGAAATCGAAAGTTCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1551s1c1
Sequence:CCGGCTTCAGATATGTCCAGAACTTCTCGAGAAGTTCTGGACATATCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1225s1c1
Sequence:CCGGGCCAAGTCATTTCAAAGACATCTCGAGATGTCTTTGAAATGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-234s1c1
Sequence:CCGGGCTGGATATTTCCCAGAAGAACTCGAGTTCTTCTGGGAAATATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152262.2-2053s21c1
Sequence:CCGGATGCAAACAAGCATTCAATTACTCGAGTAATTGAATGCTTGTTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152262.2-282s21c1
Sequence:CCGGTTCTGGAACCTGACCTCTATACTCGAGTATAGAGGTCAGGTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152262
ZNF439 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 439
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-568s1c1
Sequence:CCGGGCATGTGAATGTCAGGAATATCTCGAGATATTCCTGACATTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1561s1c1
Sequence:CCGGGTCCAGAACTTTCGATTTCATCTCGAGATGAAATCGAAAGTTCTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1551s1c1
Sequence:CCGGCTTCAGATATGTCCAGAACTTCTCGAGAAGTTCTGGACATATCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-1225s1c1
Sequence:CCGGGCCAAGTCATTTCAAAGACATCTCGAGATGTCTTTGAAATGACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152262.1-234s1c1
Sequence:CCGGGCTGGATATTTCCCAGAAGAACTCGAGTTCTTCTGGGAAATATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152262.2-2053s21c1
Sequence:CCGGATGCAAACAAGCATTCAATTACTCGAGTAATTGAATGCTTGTTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152262.2-282s21c1
Sequence:CCGGTTCTGGAACCTGACCTCTATACTCGAGTATAGAGGTCAGGTTCCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks