EMAIL THIS PAGE TO A FRIEND

ZNF43

zinc finger protein 43

Synonyms: HTF6 KOX27 ZNF39L1
UniProtKB ID: P17038, A8K5N8, P28160, Q53XQ2, Q5H9T3, Q96DG1
Gene ID:
Human(7594) Summary: This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
dog(482273) zinc finger protein 43
dog(611583) zinc finger protein 43
cow(515089) zinc finger protein 43
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003423 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155361 MISSION® esiRNA esiRNA human ZNF43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003423 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062562 predicted 2358
2 SASI_Hs01_00062563 predicted 2439
3 SASI_Hs01_00062564 predicted 2429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003423
ZNF43 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 43
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-322s21c1
Sequence:CCGGGCCTATGAGGAGACATGAAATCTCGAGATTTCATGTCTCCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-689s21c1
Sequence:CCGGCCACATCTAGCTCAACATAAACTCGAGTTTATGTTGAGCTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-767s21c1
Sequence:CCGGTGCCCTTCAATCATCACTAAACTCGAGTTTAGTGATGATTGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003423.2-2696s21c1
Sequence:GTACCGGATTAATGCTCGTACCTTATTGCTCGAGCAATAAGGTACGAGCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-2505s21c1
Sequence:CCGGCTGAAGATGTGACAGTGATTTCTCGAGAAATCACTGTCACATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-2694s1c1
Sequence:CCGGCTGAAGATGTGACAGTGATTTCTCGAGAAATCACTGTCACATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-544s1c1
Sequence:CCGGCCCAGTTATGTGTTCTCATTTCTCGAGAAATGAGAACACATAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-2471s1c1
Sequence:CCGGCCCTCAAACCTTATTGAACATCTCGAGATGTTCAATAAGGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003423
ZNF43 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 43
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-322s21c1
Sequence:CCGGGCCTATGAGGAGACATGAAATCTCGAGATTTCATGTCTCCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-689s21c1
Sequence:CCGGCCACATCTAGCTCAACATAAACTCGAGTTTATGTTGAGCTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-767s21c1
Sequence:CCGGTGCCCTTCAATCATCACTAAACTCGAGTTTAGTGATGATTGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003423.2-2696s21c1
Sequence:GTACCGGATTAATGCTCGTACCTTATTGCTCGAGCAATAAGGTACGAGCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-2505s21c1
Sequence:CCGGCTGAAGATGTGACAGTGATTTCTCGAGAAATCACTGTCACATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-2694s1c1
Sequence:CCGGCTGAAGATGTGACAGTGATTTCTCGAGAAATCACTGTCACATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-544s1c1
Sequence:CCGGCCCAGTTATGTGTTCTCATTTCTCGAGAAATGAGAACACATAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-2471s1c1
Sequence:CCGGCCCTCAAACCTTATTGAACATCTCGAGATGTTCAATAAGGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003423
ZNF43 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 43
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-322s21c1
Sequence:CCGGGCCTATGAGGAGACATGAAATCTCGAGATTTCATGTCTCCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-689s21c1
Sequence:CCGGCCACATCTAGCTCAACATAAACTCGAGTTTATGTTGAGCTAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-767s21c1
Sequence:CCGGTGCCCTTCAATCATCACTAAACTCGAGTTTAGTGATGATTGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003423.2-2696s21c1
Sequence:GTACCGGATTAATGCTCGTACCTTATTGCTCGAGCAATAAGGTACGAGCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003423.2-2505s21c1
Sequence:CCGGCTGAAGATGTGACAGTGATTTCTCGAGAAATCACTGTCACATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-2694s1c1
Sequence:CCGGCTGAAGATGTGACAGTGATTTCTCGAGAAATCACTGTCACATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-544s1c1
Sequence:CCGGCCCAGTTATGTGTTCTCATTTCTCGAGAAATGAGAACACATAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003423.1-2471s1c1
Sequence:CCGGCCCTCAAACCTTATTGAACATCTCGAGATGTTCAATAAGGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks