EMAIL THIS PAGE TO A FRIEND

ZNF440

zinc finger protein 440

Species: Human ZNF440(126070)
UniProtKB ID: Q8IYI8, Q8N1R9
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152357 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365991 predicted 959
2 SASI_Hs02_00365992 predicted 1446
3 SASI_Hs02_00365993 predicted 1290
4 SASI_Hs02_00365994 predicted 1927
5 SASI_Hs02_00365995 predicted 1138
6 SASI_Hs02_00365996 predicted 699
7 SASI_Hs02_00365997 predicted 667
8 SASI_Hs02_00365998 predicted 1771
9 SASI_Hs02_00365999 predicted 1926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152357
ZNF440 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 440
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-626s1c1
Sequence:CCGGCCTCCTTTAGAACACAAGAAACTCGAGTTTCTTGTGTTCTAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1627s1c1
Sequence:CCGGCGTTCAGTAGTTCCTTCAGTACTCGAGTACTGAAGGAACTACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1729s1c1
Sequence:CCGGGAGCTGTGTCAATCCTTTGAACTCGAGTTCAAAGGATTGACACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1785s1c1
Sequence:CCGGGAGTGTGAGCAATGACGGAAACTCGAGTTTCCGTCATTGCTCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-216s1c1
Sequence:CCGGGCTGGATATTTCCCAGAGGAACTCGAGTTCCTCTGGGAAATATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1449s21c1
Sequence:CCGGAGCCTTCAGATATGTGAATAACTCGAGTTATTCACATATCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1834s21c1
Sequence:CCGGTACGTGGTAGGACACACAATGCTCGAGCATTGTGTGTCCTACCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1558s21c1
Sequence:CCGGTATTGTCCCAAATCATTTCAACTCGAGTTGAAATGATTTGGGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1722s21c1
Sequence:CCGGGCCTTCAGAGCTGTGTCAATCCTCGAGGATTGACACAGCTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152357.2-2954s21c1
Sequence:CCGGTGTATTAGATCAGCCTTATACCTCGAGGTATAAGGCTGATCTAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152357
ZNF440 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 440
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-626s1c1
Sequence:CCGGCCTCCTTTAGAACACAAGAAACTCGAGTTTCTTGTGTTCTAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1627s1c1
Sequence:CCGGCGTTCAGTAGTTCCTTCAGTACTCGAGTACTGAAGGAACTACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1729s1c1
Sequence:CCGGGAGCTGTGTCAATCCTTTGAACTCGAGTTCAAAGGATTGACACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1785s1c1
Sequence:CCGGGAGTGTGAGCAATGACGGAAACTCGAGTTTCCGTCATTGCTCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-216s1c1
Sequence:CCGGGCTGGATATTTCCCAGAGGAACTCGAGTTCCTCTGGGAAATATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1449s21c1
Sequence:CCGGAGCCTTCAGATATGTGAATAACTCGAGTTATTCACATATCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1834s21c1
Sequence:CCGGTACGTGGTAGGACACACAATGCTCGAGCATTGTGTGTCCTACCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1558s21c1
Sequence:CCGGTATTGTCCCAAATCATTTCAACTCGAGTTGAAATGATTTGGGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1722s21c1
Sequence:CCGGGCCTTCAGAGCTGTGTCAATCCTCGAGGATTGACACAGCTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152357.2-2954s21c1
Sequence:CCGGTGTATTAGATCAGCCTTATACCTCGAGGTATAAGGCTGATCTAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152357
ZNF440 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 440
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-626s1c1
Sequence:CCGGCCTCCTTTAGAACACAAGAAACTCGAGTTTCTTGTGTTCTAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1627s1c1
Sequence:CCGGCGTTCAGTAGTTCCTTCAGTACTCGAGTACTGAAGGAACTACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1729s1c1
Sequence:CCGGGAGCTGTGTCAATCCTTTGAACTCGAGTTCAAAGGATTGACACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-1785s1c1
Sequence:CCGGGAGTGTGAGCAATGACGGAAACTCGAGTTTCCGTCATTGCTCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152357.1-216s1c1
Sequence:CCGGGCTGGATATTTCCCAGAGGAACTCGAGTTCCTCTGGGAAATATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1449s21c1
Sequence:CCGGAGCCTTCAGATATGTGAATAACTCGAGTTATTCACATATCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1834s21c1
Sequence:CCGGTACGTGGTAGGACACACAATGCTCGAGCATTGTGTGTCCTACCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1558s21c1
Sequence:CCGGTATTGTCCCAAATCATTTCAACTCGAGTTGAAATGATTTGGGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152357.2-1722s21c1
Sequence:CCGGGCCTTCAGAGCTGTGTCAATCCTCGAGGATTGACACAGCTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152357.2-2954s21c1
Sequence:CCGGTGTATTAGATCAGCCTTATACCTCGAGGTATAAGGCTGATCTAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks