EMAIL THIS PAGE TO A FRIEND

ZNF442

zinc finger protein 442

Species: Human ZNF442(79973)
UniProtKB ID: Q9H7R0
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030824 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104891 MISSION® esiRNA esiRNA human ZNF799 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030824 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235466 predicted 1428
2 SASI_Hs01_00235467 predicted 1026
3 SASI_Hs01_00235468 predicted 1091
4 SASI_Hs01_00235470 predicted 1196
5 SASI_Hs01_00235471 predicted 989
6 SASI_Hs01_00235472 predicted 977
7 SASI_Hs01_00235473 predicted 1431
8 SASI_Hs01_00235474 predicted 900
9 SASI_Hs01_00235475 predicted 2402
10 SASI_Hs02_00358409 predicted 989
11 SASI_Hs01_00235469 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030824
ZNF442 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 442
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-1172s1c1
Sequence:CCGGCGAAGACACATAATAGTACAACTCGAGTTGTACTATTATGTGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-656s1c1
Sequence:CCGGCAATATGATTCAGTAGCCTTTCTCGAGAAAGGCTACTGAATCATATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-626s1c1
Sequence:CCGGCCTGACTCTCAGACTAATGAACTCGAGTTCATTAGTCTGAGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-841s1c1
Sequence:CCGGGAGCCTAAGATGTCATATCATCTCGAGATGATATGACATCTTAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-1820s1c1
Sequence:CCGGGCCTTCATTTATCCCAGTGTACTCGAGTACACTGGGATAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030824.2-902s21c1
Sequence:CCGGTGAAAGTCGCCAGCCAGATAGCTCGAGCTATCTGGCTGGCGACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030824.2-1337s21c1
Sequence:CCGGTTGTAAAGCCTTCCCTATTTACTCGAGTAAATAGGGAAGGCTTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030824
ZNF442 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 442
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-1172s1c1
Sequence:CCGGCGAAGACACATAATAGTACAACTCGAGTTGTACTATTATGTGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-656s1c1
Sequence:CCGGCAATATGATTCAGTAGCCTTTCTCGAGAAAGGCTACTGAATCATATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-626s1c1
Sequence:CCGGCCTGACTCTCAGACTAATGAACTCGAGTTCATTAGTCTGAGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-841s1c1
Sequence:CCGGGAGCCTAAGATGTCATATCATCTCGAGATGATATGACATCTTAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-1820s1c1
Sequence:CCGGGCCTTCATTTATCCCAGTGTACTCGAGTACACTGGGATAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030824.2-902s21c1
Sequence:CCGGTGAAAGTCGCCAGCCAGATAGCTCGAGCTATCTGGCTGGCGACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030824.2-1337s21c1
Sequence:CCGGTTGTAAAGCCTTCCCTATTTACTCGAGTAAATAGGGAAGGCTTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030824
ZNF442 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 442
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-1172s1c1
Sequence:CCGGCGAAGACACATAATAGTACAACTCGAGTTGTACTATTATGTGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-656s1c1
Sequence:CCGGCAATATGATTCAGTAGCCTTTCTCGAGAAAGGCTACTGAATCATATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-626s1c1
Sequence:CCGGCCTGACTCTCAGACTAATGAACTCGAGTTCATTAGTCTGAGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-841s1c1
Sequence:CCGGGAGCCTAAGATGTCATATCATCTCGAGATGATATGACATCTTAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030824.1-1820s1c1
Sequence:CCGGGCCTTCATTTATCCCAGTGTACTCGAGTACACTGGGATAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030824.2-902s21c1
Sequence:CCGGTGAAAGTCGCCAGCCAGATAGCTCGAGCTATCTGGCTGGCGACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030824.2-1337s21c1
Sequence:CCGGTTGTAAAGCCTTCCCTATTTACTCGAGTAAATAGGGAAGGCTTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks