EMAIL THIS PAGE TO A FRIEND

ZNF443

zinc finger protein 443

Synonyms: ZK1
Species: Human ZNF443(10224)
UniProtKB ID: Q9Y2A4
Gene ID:
Human(10224) Summary: Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005815 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105921 MISSION® esiRNA esiRNA human ZNF443 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005815 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090387 predicted 1627
2 SASI_Hs01_00090388 predicted 1625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005815
VALIDATED
ZNF443 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 443
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005815.4-1528s21c1
Sequence:GTACCGGACTGCAGAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTCTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005815.4-2082s21c1
Sequence:GTACCGGCAGTTCCTTGCATAGACATAACTCGAGTTATGTCTATGCAAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005815.4-2322s21c1
Sequence:GTACCGGGGTAAAGCCTTAAGTAGTTTCCTCGAGGAAACTACTTAAGGCTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005815.4-1612s21c1
Sequence:GTACCGGACTGGAGAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTCTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005815.2-2363s1c1
Sequence:CCGGCCTCTTGTATAGTCTCAATTACTCGAGTAATTGAGACTATACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005815.2-1850s1c1
Sequence:CCGGTGAGAGAGAAATCCTATGAATCTCGAGATTCATAGGATTTCTCTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005815.2-818s1c1
Sequence:CCGGCCTATCTAAGACATGAAAGAACTCGAGTTCTTTCATGTCTTAGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005815.2-249s1c1
Sequence:CCGGCCAGAACATTGAAGATCAATACTCGAGTATTGATCTTCAATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005815.2-1722s1c1
Sequence:CCGGCTTCGGTCATTATGATAACTTCTCGAGAAGTTATCATAATGACCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005815
VALIDATED
ZNF443 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 443
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005815.4-1528s21c1
Sequence:GTACCGGACTGCAGAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTCTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005815.4-2082s21c1
Sequence:GTACCGGCAGTTCCTTGCATAGACATAACTCGAGTTATGTCTATGCAAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005815.4-2322s21c1
Sequence:GTACCGGGGTAAAGCCTTAAGTAGTTTCCTCGAGGAAACTACTTAAGGCTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005815.4-1612s21c1
Sequence:GTACCGGACTGGAGAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTCTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005815.2-2363s1c1
Sequence:CCGGCCTCTTGTATAGTCTCAATTACTCGAGTAATTGAGACTATACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005815.2-1850s1c1
Sequence:CCGGTGAGAGAGAAATCCTATGAATCTCGAGATTCATAGGATTTCTCTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005815.2-818s1c1
Sequence:CCGGCCTATCTAAGACATGAAAGAACTCGAGTTCTTTCATGTCTTAGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005815.2-249s1c1
Sequence:CCGGCCAGAACATTGAAGATCAATACTCGAGTATTGATCTTCAATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005815.2-1722s1c1
Sequence:CCGGCTTCGGTCATTATGATAACTTCTCGAGAAGTTATCATAATGACCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005815
VALIDATED
ZNF443 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 443
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005815.4-1528s21c1
Sequence:GTACCGGACTGCAGAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTCTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005815.4-2082s21c1
Sequence:GTACCGGCAGTTCCTTGCATAGACATAACTCGAGTTATGTCTATGCAAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005815.4-2322s21c1
Sequence:GTACCGGGGTAAAGCCTTAAGTAGTTTCCTCGAGGAAACTACTTAAGGCTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005815.4-1612s21c1
Sequence:GTACCGGACTGGAGAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTCTCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005815.2-2363s1c1
Sequence:CCGGCCTCTTGTATAGTCTCAATTACTCGAGTAATTGAGACTATACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005815.2-1850s1c1
Sequence:CCGGTGAGAGAGAAATCCTATGAATCTCGAGATTCATAGGATTTCTCTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005815.2-818s1c1
Sequence:CCGGCCTATCTAAGACATGAAAGAACTCGAGTTCTTTCATGTCTTAGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005815.2-249s1c1
Sequence:CCGGCCAGAACATTGAAGATCAATACTCGAGTATTGATCTTCAATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005815.2-1722s1c1
Sequence:CCGGCTTCGGTCATTATGATAACTTCTCGAGAAGTTATCATAATGACCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks