EMAIL THIS PAGE TO A FRIEND

ZNF444

zinc finger protein 444

Synonyms: EZF-2 EZF2 ZSCAN17
UniProtKB ID: Q8N0Y2, Q8TEQ9, Q8WU35, Q9NUU1
Gene ID:
Human(55311) Summary: This gene encodes a zinc finger protein which activates transcription of a scavenger receptor gene involved in the degradation of acetylated low density lipoprotein (Ac-LDL) (PMID: 11978792). This gene is located in a cluster of zinc finger genes on chromosome 19 at q13.4. A pseudogene of this gene is located on chromosome 15. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
dog(611205) zinc finger protein 444
domestic guinea pig(100714525) zinc finger protein 444
naked mole-rat(101719707) zinc finger protein 444
cow(100126046) zinc finger protein 444
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018337 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018337 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164684 predicted 754
2 SASI_Hs01_00164685 predicted 1227
3 SASI_Hs01_00164686 predicted 957
4 SASI_Hs01_00164687 predicted 751
5 SASI_Hs01_00164688 predicted 933
6 SASI_Hs01_00164689 predicted 1149
7 SASI_Hs01_00164690 predicted 1080
8 SASI_Hs01_00164691 predicted 699
9 SASI_Hs01_00164692 predicted 1813
10 SASI_Hs01_00164693 predicted 1806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018337
ZNF444 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 444
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018337.2-1471s1c1
Sequence:CCGGGCGCCTCCCTTGTCTGAACTTCTCGAGAAGTTCAGACAAGGGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-961s1c1
Sequence:CCGGGCAGAGCCACTCGGGCGAGAACTCGAGTTCTCGCCCGAGTGGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-735s1c1
Sequence:CCGGCCACAGGTGGAAAGGAGGACACTCGAGTGTCCTCCTTTCCACCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-1128s1c1
Sequence:CCGGAGTGTGGCAAGACCTTCTACTCTCGAGAGTAGAAGGTCTTGCCACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-752s1c1
Sequence:CCGGGACAGTGGGATGATTCCCTTACTCGAGTAAGGGAATCATCCCACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-961s21c1
Sequence:CCGGGCAGAGCCACTCGGGCGAGAACTCGAGTTCTCGCCCGAGTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018337.2-1471s21c1
Sequence:CCGGGCGCCTCCCTTGTCTGAACTTCTCGAGAAGTTCAGACAAGGGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-760s21c1
Sequence:CCGGGATGATTCCCTTAGCAGGCACCTCGAGGTGCCTGCTAAGGGAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-747s21c1
Sequence:CCGGAGGAGGACAGTGGGATGATTCCTCGAGGAATCATCCCACTGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-1128s21c1
Sequence:CCGGAGTGTGGCAAGACCTTCTACTCTCGAGAGTAGAAGGTCTTGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018337
ZNF444 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 444
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018337.2-1471s1c1
Sequence:CCGGGCGCCTCCCTTGTCTGAACTTCTCGAGAAGTTCAGACAAGGGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-961s1c1
Sequence:CCGGGCAGAGCCACTCGGGCGAGAACTCGAGTTCTCGCCCGAGTGGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-735s1c1
Sequence:CCGGCCACAGGTGGAAAGGAGGACACTCGAGTGTCCTCCTTTCCACCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-1128s1c1
Sequence:CCGGAGTGTGGCAAGACCTTCTACTCTCGAGAGTAGAAGGTCTTGCCACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-752s1c1
Sequence:CCGGGACAGTGGGATGATTCCCTTACTCGAGTAAGGGAATCATCCCACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-961s21c1
Sequence:CCGGGCAGAGCCACTCGGGCGAGAACTCGAGTTCTCGCCCGAGTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018337.2-1471s21c1
Sequence:CCGGGCGCCTCCCTTGTCTGAACTTCTCGAGAAGTTCAGACAAGGGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-760s21c1
Sequence:CCGGGATGATTCCCTTAGCAGGCACCTCGAGGTGCCTGCTAAGGGAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-747s21c1
Sequence:CCGGAGGAGGACAGTGGGATGATTCCTCGAGGAATCATCCCACTGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-1128s21c1
Sequence:CCGGAGTGTGGCAAGACCTTCTACTCTCGAGAGTAGAAGGTCTTGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018337
ZNF444 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 444
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018337.2-1471s1c1
Sequence:CCGGGCGCCTCCCTTGTCTGAACTTCTCGAGAAGTTCAGACAAGGGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-961s1c1
Sequence:CCGGGCAGAGCCACTCGGGCGAGAACTCGAGTTCTCGCCCGAGTGGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-735s1c1
Sequence:CCGGCCACAGGTGGAAAGGAGGACACTCGAGTGTCCTCCTTTCCACCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-1128s1c1
Sequence:CCGGAGTGTGGCAAGACCTTCTACTCTCGAGAGTAGAAGGTCTTGCCACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018337.2-752s1c1
Sequence:CCGGGACAGTGGGATGATTCCCTTACTCGAGTAAGGGAATCATCCCACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-961s21c1
Sequence:CCGGGCAGAGCCACTCGGGCGAGAACTCGAGTTCTCGCCCGAGTGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018337.2-1471s21c1
Sequence:CCGGGCGCCTCCCTTGTCTGAACTTCTCGAGAAGTTCAGACAAGGGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-760s21c1
Sequence:CCGGGATGATTCCCTTAGCAGGCACCTCGAGGTGCCTGCTAAGGGAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-747s21c1
Sequence:CCGGAGGAGGACAGTGGGATGATTCCTCGAGGAATCATCCCACTGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018337.2-1128s21c1
Sequence:CCGGAGTGTGGCAAGACCTTCTACTCTCGAGAGTAGAAGGTCTTGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks