EMAIL THIS PAGE TO A FRIEND

ZNF445

zinc finger protein 445

Synonyms: ZKSCAN15 ZNF168 ZSCAN47
UniProtKB ID: P59923, Q3MJD1
Gene ID:
dog(477008) zinc finger protein 445
Horse(100066288) zinc finger protein 445
domestic cat(101099145) zinc finger protein 445
cow(540408) zinc finger protein 445
sheep(101119511) zinc finger protein 445
naked mole-rat(101707247) zinc finger protein 445
Domestic Rabbit(100345077) zinc finger protein 445
domestic guinea pig(100714977) zinc finger protein 445
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102879 Anti-ZNF445 antibody produced in rabbit affinity isolated antibody human, mouse, rat, rabbit, horse, canine
western blot pricing
HPA006678 Anti-ZNF445 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181489 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061951 MISSION® esiRNA esiRNA human ZNF445 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181489 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370105 predicted 3055
2 SASI_Hs01_00010133 predicted 1961
3 SASI_Hs01_00010134 predicted 1518
4 SASI_Hs01_00010135 predicted 3317
5 SASI_Hs01_00010136 predicted 3397
6 SASI_Hs01_00010137 predicted 1447
7 SASI_Hs01_00010138 predicted 2246
8 SASI_Hs02_00370106 predicted 2610
9 SASI_Hs02_00370107 predicted 2306
10 SASI_Hs02_00370108 predicted 2773
11 SASI_Hs01_00010131 predicted 837
12 SASI_Hs01_00010132 predicted 1575
13 SASI_Hs01_00010139 predicted 3066
14 SASI_Hs01_00010140 predicted 2127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181489
VALIDATED
ZNF445 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 445
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2259s21c1
Sequence:CCGGATCAAACTTTACTCGTCATATCTCGAGATATGACGAGTAAAGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1449s21c1
Sequence:CCGGTCCCATACAAGTAAGAGTTAACTCGAGTTAACTCTTACTTGTATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2946s21c1
Sequence:CCGGGCGCTATAAATGTAATCTATGCTCGAGCATAGATTACATTTATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1512s21c1
Sequence:CCGGTGAAGTATCAGGAAGTAATAGCTCGAGCTATTACTTCCTGATACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2511s21c1
Sequence:CCGGGTCAGCCTTTATTGTTCATAACTCGAGTTATGAACAATAAAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1422s21c1
Sequence:CCGGGAGCAGGCAGAAGGATCAATGCTCGAGCATTGATCCTTCTGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-896s21c1
Sequence:CCGGTGGAGCCTCCCTATGAAATAGCTCGAGCTATTTCATAGGGAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-3311s21c1
Sequence:CCGGACAAGAGTTCACAACTCATTACTCGAGTAATGAGTTGTGAACTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2982s21c1
Sequence:CCGGTAGAAACTATCGCCTTGTTAACTCGAGTTAACAAGGCGATAGTTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-411s1c1
Sequence:CCGGGCGGCTTCAGACAGTAAAGAACTCGAGTTCTTTACTGTCTGAAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-1595s1c1
Sequence:CCGGGCTGTGGCAAACACTTCAGAACTCGAGTTCTGAAGTGTTTGCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_181489.3-2740s1c1
Sequence:CCGGGCCTTCAGATGGAGTTCCAATCTCGAGATTGGAACTCCATCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-1373s1c1
Sequence:CCGGCGACAAGTGTTTCTGAGGGAACTCGAGTTCCCTCAGAAACACTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-3015s1c1
Sequence:CCGGCCACTCTACAGAGAGACCTTTCTCGAGAAAGGTCTCTCTGTAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181489
VALIDATED
ZNF445 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 445
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2259s21c1
Sequence:CCGGATCAAACTTTACTCGTCATATCTCGAGATATGACGAGTAAAGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1449s21c1
Sequence:CCGGTCCCATACAAGTAAGAGTTAACTCGAGTTAACTCTTACTTGTATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2946s21c1
Sequence:CCGGGCGCTATAAATGTAATCTATGCTCGAGCATAGATTACATTTATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1512s21c1
Sequence:CCGGTGAAGTATCAGGAAGTAATAGCTCGAGCTATTACTTCCTGATACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2511s21c1
Sequence:CCGGGTCAGCCTTTATTGTTCATAACTCGAGTTATGAACAATAAAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1422s21c1
Sequence:CCGGGAGCAGGCAGAAGGATCAATGCTCGAGCATTGATCCTTCTGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-896s21c1
Sequence:CCGGTGGAGCCTCCCTATGAAATAGCTCGAGCTATTTCATAGGGAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-3311s21c1
Sequence:CCGGACAAGAGTTCACAACTCATTACTCGAGTAATGAGTTGTGAACTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2982s21c1
Sequence:CCGGTAGAAACTATCGCCTTGTTAACTCGAGTTAACAAGGCGATAGTTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-411s1c1
Sequence:CCGGGCGGCTTCAGACAGTAAAGAACTCGAGTTCTTTACTGTCTGAAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-1595s1c1
Sequence:CCGGGCTGTGGCAAACACTTCAGAACTCGAGTTCTGAAGTGTTTGCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_181489.3-2740s1c1
Sequence:CCGGGCCTTCAGATGGAGTTCCAATCTCGAGATTGGAACTCCATCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-1373s1c1
Sequence:CCGGCGACAAGTGTTTCTGAGGGAACTCGAGTTCCCTCAGAAACACTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-3015s1c1
Sequence:CCGGCCACTCTACAGAGAGACCTTTCTCGAGAAAGGTCTCTCTGTAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181489
VALIDATED
ZNF445 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 445
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2259s21c1
Sequence:CCGGATCAAACTTTACTCGTCATATCTCGAGATATGACGAGTAAAGTTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1449s21c1
Sequence:CCGGTCCCATACAAGTAAGAGTTAACTCGAGTTAACTCTTACTTGTATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2946s21c1
Sequence:CCGGGCGCTATAAATGTAATCTATGCTCGAGCATAGATTACATTTATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1512s21c1
Sequence:CCGGTGAAGTATCAGGAAGTAATAGCTCGAGCTATTACTTCCTGATACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2511s21c1
Sequence:CCGGGTCAGCCTTTATTGTTCATAACTCGAGTTATGAACAATAAAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-1422s21c1
Sequence:CCGGGAGCAGGCAGAAGGATCAATGCTCGAGCATTGATCCTTCTGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-896s21c1
Sequence:CCGGTGGAGCCTCCCTATGAAATAGCTCGAGCTATTTCATAGGGAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-3311s21c1
Sequence:CCGGACAAGAGTTCACAACTCATTACTCGAGTAATGAGTTGTGAACTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181489.5-2982s21c1
Sequence:CCGGTAGAAACTATCGCCTTGTTAACTCGAGTTAACAAGGCGATAGTTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-411s1c1
Sequence:CCGGGCGGCTTCAGACAGTAAAGAACTCGAGTTCTTTACTGTCTGAAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-1595s1c1
Sequence:CCGGGCTGTGGCAAACACTTCAGAACTCGAGTTCTGAAGTGTTTGCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_181489.3-2740s1c1
Sequence:CCGGGCCTTCAGATGGAGTTCCAATCTCGAGATTGGAACTCCATCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-1373s1c1
Sequence:CCGGCGACAAGTGTTTCTGAGGGAACTCGAGTTCCCTCAGAAACACTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181489.3-3015s1c1
Sequence:CCGGCCACTCTACAGAGAGACCTTTCTCGAGAAAGGTCTCTCTGTAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks