EMAIL THIS PAGE TO A FRIEND

ZNF446

zinc finger protein 446

Synonyms: ZKSCAN20 ZSCAN30 ZSCAN52
UniProtKB ID: Q9NWS9
Gene ID:
domestic guinea pig(101789134) zinc finger protein 446
naked mole-rat(101724529) zinc finger protein 446
cow(615990) zinc finger protein 446
sheep(101120434) zinc finger protein 446
domestic cat(101086463) zinc finger protein 446
dog(100684106) zinc finger protein 446
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017908 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158781 MISSION® esiRNA esiRNA human ZNF446 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017908 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011738 predicted 619
2 SASI_Hs01_00011739 predicted 1456
3 SASI_Hs01_00011740 predicted 1104
4 SASI_Hs01_00011741 predicted 438
5 SASI_Hs01_00011742 predicted 1143
6 SASI_Hs01_00011743 predicted 1380
7 SASI_Hs01_00011744 predicted 1291
8 SASI_Hs01_00011745 predicted 1130
9 SASI_Hs01_00011746 predicted 1144
10 SASI_Hs01_00011747 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017908
ZNF446 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 446
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-505s1c1
Sequence:CCGGCAGAAGACAGAGGAACCACTTCTCGAGAAGTGGTTCCTCTGTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-207s1c1
Sequence:CCGGCCGAGGGTTCTGCTACCAGGACTCGAGTCCTGGTAGCAGAACCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-1428s1c1
Sequence:CCGGGCAGCTGGTCATCCACCGCAACTCGAGTTGCGGTGGATGACCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-628s1c1
Sequence:CCGGCCCAATGTCGATGGACAGGAACTCGAGTTCCTGTCCATCGACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-1140s1c1
Sequence:CCGGCTTCGACTGGAAGTCAGTGTTCTCGAGAACACTGACTTCCAGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017908.2-1687s21c1
Sequence:CCGGAGGTCTGGGTTCCCTTCTATGCTCGAGCATAGAAGGGAACCCAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017908.2-445s21c1
Sequence:CCGGCAACTGTTGGGCTGGATCACACTCGAGTGTGATCCAGCCCAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017908.2-1805s21c1
Sequence:CCGGTGCCTCAGGTGGGTGTTCAAACTCGAGTTTGAACACCCACCTGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017908.2-904s21c1
Sequence:CCGGAGAAGCCTGCGCTCGGGAAATCTCGAGATTTCCCGAGCGCAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017908
ZNF446 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 446
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-505s1c1
Sequence:CCGGCAGAAGACAGAGGAACCACTTCTCGAGAAGTGGTTCCTCTGTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-207s1c1
Sequence:CCGGCCGAGGGTTCTGCTACCAGGACTCGAGTCCTGGTAGCAGAACCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-1428s1c1
Sequence:CCGGGCAGCTGGTCATCCACCGCAACTCGAGTTGCGGTGGATGACCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-628s1c1
Sequence:CCGGCCCAATGTCGATGGACAGGAACTCGAGTTCCTGTCCATCGACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-1140s1c1
Sequence:CCGGCTTCGACTGGAAGTCAGTGTTCTCGAGAACACTGACTTCCAGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017908.2-1687s21c1
Sequence:CCGGAGGTCTGGGTTCCCTTCTATGCTCGAGCATAGAAGGGAACCCAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017908.2-445s21c1
Sequence:CCGGCAACTGTTGGGCTGGATCACACTCGAGTGTGATCCAGCCCAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017908.2-1805s21c1
Sequence:CCGGTGCCTCAGGTGGGTGTTCAAACTCGAGTTTGAACACCCACCTGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017908.2-904s21c1
Sequence:CCGGAGAAGCCTGCGCTCGGGAAATCTCGAGATTTCCCGAGCGCAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017908
ZNF446 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 446
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-505s1c1
Sequence:CCGGCAGAAGACAGAGGAACCACTTCTCGAGAAGTGGTTCCTCTGTCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-207s1c1
Sequence:CCGGCCGAGGGTTCTGCTACCAGGACTCGAGTCCTGGTAGCAGAACCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-1428s1c1
Sequence:CCGGGCAGCTGGTCATCCACCGCAACTCGAGTTGCGGTGGATGACCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-628s1c1
Sequence:CCGGCCCAATGTCGATGGACAGGAACTCGAGTTCCTGTCCATCGACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017908.1-1140s1c1
Sequence:CCGGCTTCGACTGGAAGTCAGTGTTCTCGAGAACACTGACTTCCAGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017908.2-1687s21c1
Sequence:CCGGAGGTCTGGGTTCCCTTCTATGCTCGAGCATAGAAGGGAACCCAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017908.2-445s21c1
Sequence:CCGGCAACTGTTGGGCTGGATCACACTCGAGTGTGATCCAGCCCAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017908.2-1805s21c1
Sequence:CCGGTGCCTCAGGTGGGTGTTCAAACTCGAGTTTGAACACCCACCTGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017908.2-904s21c1
Sequence:CCGGAGAAGCCTGCGCTCGGGAAATCTCGAGATTTCCCGAGCGCAGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks