EMAIL THIS PAGE TO A FRIEND

ZNF449

zinc finger protein 449

Synonyms: ZSCAN19
UniProtKB ID: Q6P9G9, Q5JRZ7, Q5JRZ8, Q6NZX2, Q8N3Q1, Q8TED7
Gene ID:
Human(203523) Summary: This gene encodes a nuclear protein that likely functions as a transcription factor. The protein includes an N-terminal SCAN domain, and seven C2H2-type zinc finger motifs. [provided by RefSeq, May 2010]
dog(492160) zinc finger protein 449
Horse(100057349) zinc finger protein 449
domestic cat(101097052) zinc finger protein 449
cow(512036) zinc finger protein 449
Domestic Rabbit(100356590) zinc finger protein 449
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31647 Anti-ZNF449 (AB1) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, pig, canine, rabbit, bovine, horse, human, rat
western blot pricing
AV32254 Anti-ZNF449 (AB2) antibody produced in rabbit affinity isolated antibody rat, guinea pig, mouse, horse, bovine, human, rabbit
western blot pricing
AV32994 Anti-ZNF449 (AB3) antibody produced in rabbit affinity isolated antibody canine, guinea pig, rabbit, rat, human, horse, mouse
western blot pricing
SAB1408435 Anti-ZNF449 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA018079 Anti-ZNF449 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152695 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042101 MISSION® esiRNA esiRNA human ZNF449 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152695 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058591 predicted 1439
2 SASI_Hs01_00058592 predicted 1227
3 SASI_Hs02_00366586 predicted 1444
4 SASI_Hs01_00058595 predicted 725
5 SASI_Hs01_00058596 predicted 430
6 SASI_Hs01_00058597 predicted 1298
7 SASI_Hs01_00058598 predicted 971
8 SASI_Hs01_00058599 predicted 651
9 SASI_Hs01_00058600 predicted 1314
10 SASI_Hs02_00366587 predicted 964
11 SASI_Hs01_00058593 predicted 931
12 SASI_Hs01_00058594 predicted 1491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152695
VALIDATED
ZNF449 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 449
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1330s21c1
Sequence:CCGGACTCGGCGGTCACATCTTATACTCGAGTATAAGATGTGACCGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1586s21c1
Sequence:CCGGAGAGACCAAGCCTCGTTATTCCTCGAGGAATAACGAGGCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152695.5-1246s21c1
Sequence:GTACCGGCTTCGTAGTTCAGACCTTTATCTCGAGATAAAGGTCTGAACTACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152695.5-2480s21c1
Sequence:CCGGTACTTAGTTCTGCTAGATATTCTCGAGAATATCTAGCAGAACTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1464s21c1
Sequence:CCGGACCTCATAGATGTCATAATTGCTCGAGCAATTATGACATCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-970s1c1
Sequence:CCGGCCAGAGGATTTACAGACAGATCTCGAGATCTGTCTGTAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-1571s1c1
Sequence:CCGGGCCTCGTTATTCATTTAAGAACTCGAGTTCTTAAATGAATAACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152695.2-1221s1c1
Sequence:CCGGCCTTCGTAGTTCAGACCTTTACTCGAGTAAAGGTCTGAACTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-1676s1c1
Sequence:CCGGCTCACTTTAGAGGACTTATTTCTCGAGAAATAAGTCCTCTAAAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152695.2-424s1c1
Sequence:CCGGCCAGAGAATAGAGAAAGAGTTCTCGAGAACTCTTTCTCTATTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152695
VALIDATED
ZNF449 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 449
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1330s21c1
Sequence:CCGGACTCGGCGGTCACATCTTATACTCGAGTATAAGATGTGACCGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1586s21c1
Sequence:CCGGAGAGACCAAGCCTCGTTATTCCTCGAGGAATAACGAGGCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152695.5-1246s21c1
Sequence:GTACCGGCTTCGTAGTTCAGACCTTTATCTCGAGATAAAGGTCTGAACTACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152695.5-2480s21c1
Sequence:CCGGTACTTAGTTCTGCTAGATATTCTCGAGAATATCTAGCAGAACTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1464s21c1
Sequence:CCGGACCTCATAGATGTCATAATTGCTCGAGCAATTATGACATCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-970s1c1
Sequence:CCGGCCAGAGGATTTACAGACAGATCTCGAGATCTGTCTGTAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-1571s1c1
Sequence:CCGGGCCTCGTTATTCATTTAAGAACTCGAGTTCTTAAATGAATAACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152695.2-1221s1c1
Sequence:CCGGCCTTCGTAGTTCAGACCTTTACTCGAGTAAAGGTCTGAACTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-1676s1c1
Sequence:CCGGCTCACTTTAGAGGACTTATTTCTCGAGAAATAAGTCCTCTAAAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152695.2-424s1c1
Sequence:CCGGCCAGAGAATAGAGAAAGAGTTCTCGAGAACTCTTTCTCTATTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152695
VALIDATED
ZNF449 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 449
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1330s21c1
Sequence:CCGGACTCGGCGGTCACATCTTATACTCGAGTATAAGATGTGACCGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1586s21c1
Sequence:CCGGAGAGACCAAGCCTCGTTATTCCTCGAGGAATAACGAGGCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152695.5-1246s21c1
Sequence:GTACCGGCTTCGTAGTTCAGACCTTTATCTCGAGATAAAGGTCTGAACTACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152695.5-2480s21c1
Sequence:CCGGTACTTAGTTCTGCTAGATATTCTCGAGAATATCTAGCAGAACTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152695.5-1464s21c1
Sequence:CCGGACCTCATAGATGTCATAATTGCTCGAGCAATTATGACATCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-970s1c1
Sequence:CCGGCCAGAGGATTTACAGACAGATCTCGAGATCTGTCTGTAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-1571s1c1
Sequence:CCGGGCCTCGTTATTCATTTAAGAACTCGAGTTCTTAAATGAATAACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152695.2-1221s1c1
Sequence:CCGGCCTTCGTAGTTCAGACCTTTACTCGAGTAAAGGTCTGAACTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152695.2-1676s1c1
Sequence:CCGGCTCACTTTAGAGGACTTATTTCTCGAGAAATAAGTCCTCTAAAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152695.2-424s1c1
Sequence:CCGGCCAGAGAATAGAGAAAGAGTTCTCGAGAACTCTTTCTCTATTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks