EMAIL THIS PAGE TO A FRIEND

ZNF44

zinc finger protein 44

Synonyms: GIOT-2 KOX7 ZNF ZNF504 ZNF55 ZNF58
Species: Human ZNF44(51710)
UniProtKB ID: P15621, B4DML9, B9EGJ5, B9ZVM2, P17018, Q9ULZ7
Gene ID:
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016264 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016264 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196692 predicted 452
2 SASI_Hs01_00196694 predicted 588
3 SASI_Hs01_00196695 predicted 1616
4 SASI_Hs01_00196697 predicted 1339
5 SASI_Hs01_00196698 predicted 446
6 SASI_Hs01_00196699 predicted 1406
7 SASI_Hs01_00196700 predicted 1717
8 SASI_Hs02_00349158 predicted 1301
9 SASI_Hs02_00349159 predicted 479
10 SASI_Hs02_00349160 predicted 738
11 SASI_Hs01_00196691 predicted 1347
12 SASI_Hs01_00196693 predicted 2042
13 SASI_Hs01_00196696 predicted 2090
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016264
VALIDATED
ZNF44 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 44
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016264.3-2033s21c1
Sequence:CCGGCACTGGAAGGATATTCTATAACTCGAGTTATAGAATATCCTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016264.3-2120s21c1
Sequence:CCGGTGTGAATGTAAACGTGGTAAACTCGAGTTTACCACGTTTACATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016264.3-1711s21c1
Sequence:CCGGATCTTATGAGTGTCAAATTTGCTCGAGCAAATTTGACACTCATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016264.3-593s21c1
Sequence:CCGGCACCGGGAGTGTCATGAATATCTCGAGATATTCATGACACTCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016264.3-2481s21c1
Sequence:CCGGAGAGTTGCTGCCTGCTATATGCTCGAGCATATAGCAGGCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016264.3-454s21c1
Sequence:CCGGCTTAAGCCAGATTCGAAATAGCTCGAGCTATTTCGAATCTGGCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1312s1c1
Sequence:CCGGGCCCTCATAAATGCACAGTATCTCGAGATACTGTGCATTTATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1770s1c1
Sequence:CCGGCCCTCTTTCCTTCTAAGACATCTCGAGATGTCTTAGAAGGAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1653s1c1
Sequence:CCGGGAGTGTCAAATTTGTGGGAAACTCGAGTTTCCCACAAATTTGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-455s1c1
Sequence:CCGGCAGTGTGAATGGAGAAGTCATCTCGAGATGACTTCTCCATTCACACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-630s1c1
Sequence:CCGGGCTGGAAAGAAACCCTATGATCTCGAGATCATAGGGTTTCTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016264
VALIDATED
ZNF44 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 44
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016264.3-2033s21c1
Sequence:CCGGCACTGGAAGGATATTCTATAACTCGAGTTATAGAATATCCTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016264.3-2120s21c1
Sequence:CCGGTGTGAATGTAAACGTGGTAAACTCGAGTTTACCACGTTTACATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016264.3-1711s21c1
Sequence:CCGGATCTTATGAGTGTCAAATTTGCTCGAGCAAATTTGACACTCATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016264.3-593s21c1
Sequence:CCGGCACCGGGAGTGTCATGAATATCTCGAGATATTCATGACACTCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016264.3-2481s21c1
Sequence:CCGGAGAGTTGCTGCCTGCTATATGCTCGAGCATATAGCAGGCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016264.3-454s21c1
Sequence:CCGGCTTAAGCCAGATTCGAAATAGCTCGAGCTATTTCGAATCTGGCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1312s1c1
Sequence:CCGGGCCCTCATAAATGCACAGTATCTCGAGATACTGTGCATTTATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1770s1c1
Sequence:CCGGCCCTCTTTCCTTCTAAGACATCTCGAGATGTCTTAGAAGGAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1653s1c1
Sequence:CCGGGAGTGTCAAATTTGTGGGAAACTCGAGTTTCCCACAAATTTGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-455s1c1
Sequence:CCGGCAGTGTGAATGGAGAAGTCATCTCGAGATGACTTCTCCATTCACACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-630s1c1
Sequence:CCGGGCTGGAAAGAAACCCTATGATCTCGAGATCATAGGGTTTCTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016264
VALIDATED
ZNF44 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 44
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016264.3-2033s21c1
Sequence:CCGGCACTGGAAGGATATTCTATAACTCGAGTTATAGAATATCCTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016264.3-2120s21c1
Sequence:CCGGTGTGAATGTAAACGTGGTAAACTCGAGTTTACCACGTTTACATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016264.3-1711s21c1
Sequence:CCGGATCTTATGAGTGTCAAATTTGCTCGAGCAAATTTGACACTCATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016264.3-593s21c1
Sequence:CCGGCACCGGGAGTGTCATGAATATCTCGAGATATTCATGACACTCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016264.3-2481s21c1
Sequence:CCGGAGAGTTGCTGCCTGCTATATGCTCGAGCATATAGCAGGCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016264.3-454s21c1
Sequence:CCGGCTTAAGCCAGATTCGAAATAGCTCGAGCTATTTCGAATCTGGCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1312s1c1
Sequence:CCGGGCCCTCATAAATGCACAGTATCTCGAGATACTGTGCATTTATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1770s1c1
Sequence:CCGGCCCTCTTTCCTTCTAAGACATCTCGAGATGTCTTAGAAGGAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-1653s1c1
Sequence:CCGGGAGTGTCAAATTTGTGGGAAACTCGAGTTTCCCACAAATTTGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-455s1c1
Sequence:CCGGCAGTGTGAATGGAGAAGTCATCTCGAGATGACTTCTCCATTCACACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016264.1-630s1c1
Sequence:CCGGGCTGGAAAGAAACCCTATGATCTCGAGATCATAGGGTTTCTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks