EMAIL THIS PAGE TO A FRIEND

ZNF451

zinc finger protein 451

Synonyms: COASTER dJ417I1.1
Gene ID:
Zebrafish(557758) zinc finger protein 451
chicken(421881) zinc finger protein 451
domestic cat(101099964) zinc finger protein 451
Horse(100070011) zinc finger protein 451
dog(474949) zinc finger protein 451
cow(529894) zinc finger protein 451
sheep(101112267) zinc finger protein 451
naked mole-rat(101717968) zinc finger protein 451
domestic guinea pig(100727278) zinc finger protein 451
278 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108741 Anti-ZNF451 affinity isolated antibody mouse, dog, rabbit, horse, rat, human, bovine, pig
western blot pricing
SAB2102880 Anti-ZNF451 antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, canine, human, horse
western blot pricing
HPA028838 Anti-ZNF451 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015555 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031623 Rosetta Predictions human pricing
NM_015555 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133832 predicted 2504
2 SASI_Hs01_00133833 predicted 885
3 SASI_Hs01_00133834 predicted 1946
4 SASI_Hs01_00133835 predicted 1981
5 SASI_Hs02_00307656 predicted 2060
6 SASI_Hs02_00307657 predicted 3286
7 SASI_Hs01_00133836 predicted 1634
8 SASI_Hs02_00307658 predicted 746
9 SASI_Hs02_00307659 predicted 328
10 SASI_Hs01_00133838 predicted 1438
11 SASI_Hs01_00133830 predicted 675
12 SASI_Hs01_00133831 predicted 1528
13 SASI_Hs01_00133837 predicted 2082
14 SASI_Hs01_00133839 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093260 predicted 2507
2 SASI_Hs01_00093261 predicted 880
3 SASI_Hs01_00093262 predicted 1943
4 SASI_Hs01_00093263 predicted 1983
5 SASI_Hs02_00348096 predicted 2064
6 SASI_Hs02_00348097 predicted 3141
7 SASI_Hs01_00093264 predicted 1635
8 SASI_Hs02_00348098 predicted 741
9 SASI_Hs02_00348099 predicted 333
10 SASI_Hs01_00093266 predicted 1438
11 SASI_Hs01_00093258 predicted 857
12 SASI_Hs01_00093259 predicted 1716
13 SASI_Hs01_00093265 predicted 2267
14 SASI_Hs01_00093267 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015555
VALIDATED
ZNF451 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 451
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015555.2-3491s21c1
Sequence:CCGGGTATTCTAATATAGGTGTAACCTCGAGGTTACACCTATATTAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015555.2-3709s21c1
Sequence:CCGGTCTCATGTGGCACTATTATATCTCGAGATATAATAGTGCCACATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-1975s21c1
Sequence:CCGGACAAGCCTTCATCAGCTATTACTCGAGTAATAGCTGATGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-1700s21c1
Sequence:CCGGAGCAAACACAATGGGTTATAACTCGAGTTATAACCCATTGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-3224s21c1
Sequence:CCGGGGAATTAGAAGAAGCTATTAGCTCGAGCTAATAGCTTCTTCTAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-460s1c1
Sequence:CCGGGCTTTAACTCTGGCTCGTCTACTCGAGTAGACGAGCCAGAGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015555.1-3849s1c1
Sequence:CCGGGCTTTAATTAGAGCAGCACATCTCGAGATGTGCTGCTCTAATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015555.1-2398s1c1
Sequence:CCGGCGTGAGAGTTACATCTGTAAACTCGAGTTTACAGATGTAACTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-1765s1c1
Sequence:CCGGCGTTTACACATGAGCCGGATTCTCGAGAATCCGGCTCATGTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015555.1-589s1c1
Sequence:CCGGCGAGGACATTCTGATACAGAACTCGAGTTCTGTATCAGAATGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-857s1c1
Sequence:CCGGCCTTTGCTTGTGTAGTATGTTCTCGAGAACATACTACACAAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015555.1-854s1c1
Sequence:CCGGGCTCCTTTGCTTGTGTAGTATCTCGAGATACTACACAAGCAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015555
VALIDATED
ZNF451 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 451
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015555.2-3491s21c1
Sequence:CCGGGTATTCTAATATAGGTGTAACCTCGAGGTTACACCTATATTAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015555.2-3709s21c1
Sequence:CCGGTCTCATGTGGCACTATTATATCTCGAGATATAATAGTGCCACATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-1975s21c1
Sequence:CCGGACAAGCCTTCATCAGCTATTACTCGAGTAATAGCTGATGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-1700s21c1
Sequence:CCGGAGCAAACACAATGGGTTATAACTCGAGTTATAACCCATTGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-3224s21c1
Sequence:CCGGGGAATTAGAAGAAGCTATTAGCTCGAGCTAATAGCTTCTTCTAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-460s1c1
Sequence:CCGGGCTTTAACTCTGGCTCGTCTACTCGAGTAGACGAGCCAGAGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015555.1-3849s1c1
Sequence:CCGGGCTTTAATTAGAGCAGCACATCTCGAGATGTGCTGCTCTAATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015555.1-2398s1c1
Sequence:CCGGCGTGAGAGTTACATCTGTAAACTCGAGTTTACAGATGTAACTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-1765s1c1
Sequence:CCGGCGTTTACACATGAGCCGGATTCTCGAGAATCCGGCTCATGTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015555.1-589s1c1
Sequence:CCGGCGAGGACATTCTGATACAGAACTCGAGTTCTGTATCAGAATGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-857s1c1
Sequence:CCGGCCTTTGCTTGTGTAGTATGTTCTCGAGAACATACTACACAAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015555.1-854s1c1
Sequence:CCGGGCTCCTTTGCTTGTGTAGTATCTCGAGATACTACACAAGCAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015555
VALIDATED
ZNF451 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 451
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015555.2-3491s21c1
Sequence:CCGGGTATTCTAATATAGGTGTAACCTCGAGGTTACACCTATATTAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015555.2-3709s21c1
Sequence:CCGGTCTCATGTGGCACTATTATATCTCGAGATATAATAGTGCCACATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-1975s21c1
Sequence:CCGGACAAGCCTTCATCAGCTATTACTCGAGTAATAGCTGATGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-1700s21c1
Sequence:CCGGAGCAAACACAATGGGTTATAACTCGAGTTATAACCCATTGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015555.2-3224s21c1
Sequence:CCGGGGAATTAGAAGAAGCTATTAGCTCGAGCTAATAGCTTCTTCTAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-460s1c1
Sequence:CCGGGCTTTAACTCTGGCTCGTCTACTCGAGTAGACGAGCCAGAGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015555.1-3849s1c1
Sequence:CCGGGCTTTAATTAGAGCAGCACATCTCGAGATGTGCTGCTCTAATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015555.1-2398s1c1
Sequence:CCGGCGTGAGAGTTACATCTGTAAACTCGAGTTTACAGATGTAACTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-1765s1c1
Sequence:CCGGCGTTTACACATGAGCCGGATTCTCGAGAATCCGGCTCATGTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015555.1-589s1c1
Sequence:CCGGCGAGGACATTCTGATACAGAACTCGAGTTCTGTATCAGAATGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015555.1-857s1c1
Sequence:CCGGCCTTTGCTTGTGTAGTATGTTCTCGAGAACATACTACACAAGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015555.1-854s1c1
Sequence:CCGGGCTCCTTTGCTTGTGTAGTATCTCGAGATACTACACAAGCAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks