EMAIL THIS PAGE TO A FRIEND

ZNF454

zinc finger protein 454

UniProtKB ID: Q8N9F8, Q2M1P2, Q2M323
Gene ID:
domestic guinea pig(100722670) zinc finger protein 454
naked mole-rat(101717357) zinc finger protein 454
Domestic Rabbit(100340870) zinc finger protein 454
cow(525942) zinc finger protein 454
sheep(101123551) zinc finger protein 454
Horse(100067748) zinc finger protein 454
dog(100688836) zinc finger protein 454
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182594 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182594 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175545 predicted 832
2 SASI_Hs01_00175546 predicted 667
3 SASI_Hs01_00175547 predicted 1281
4 SASI_Hs01_00175548 predicted 1367
5 SASI_Hs01_00175549 predicted 1497
6 SASI_Hs01_00175551 predicted 588
7 SASI_Hs01_00175552 predicted 1270
8 SASI_Hs01_00175553 predicted 576
9 SASI_Hs02_00370734 predicted 541
10 SASI_Hs02_00370735 predicted 599
11 SASI_Hs01_00175544 predicted 1625
12 SASI_Hs01_00175550 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182594
ZNF454 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 454
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-514s1c1
Sequence:CCGGCTGTCTTGACTGGATGACTATCTCGAGATAGTCATCCAGTCAAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1134s1c1
Sequence:CCGGCCCATCATCATAGAATACATACTCGAGTATGTATTCTATGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1118s1c1
Sequence:CCGGCGAAATATACACCTTGCCCATCTCGAGATGGGCAAGGTGTATATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1213s1c1
Sequence:CCGGCCTTACCAAACACCAGAATATCTCGAGATATTCTGGTGTTTGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-776s1c1
Sequence:CCGGCAGGGATTTCAACCTAGCAAACTCGAGTTTGCTAGGTTGAAATCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182594.1-1871s21c1
Sequence:CCGGAGACTGAGTAGATGAATTATTCTCGAGAATAATTCATCTACTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182594.1-1933s21c1
Sequence:CCGGTGCATCAAGATAGTCACTTTACTCGAGTAAAGTGACTATCTTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182594
ZNF454 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 454
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-514s1c1
Sequence:CCGGCTGTCTTGACTGGATGACTATCTCGAGATAGTCATCCAGTCAAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1134s1c1
Sequence:CCGGCCCATCATCATAGAATACATACTCGAGTATGTATTCTATGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1118s1c1
Sequence:CCGGCGAAATATACACCTTGCCCATCTCGAGATGGGCAAGGTGTATATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1213s1c1
Sequence:CCGGCCTTACCAAACACCAGAATATCTCGAGATATTCTGGTGTTTGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-776s1c1
Sequence:CCGGCAGGGATTTCAACCTAGCAAACTCGAGTTTGCTAGGTTGAAATCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182594.1-1871s21c1
Sequence:CCGGAGACTGAGTAGATGAATTATTCTCGAGAATAATTCATCTACTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182594.1-1933s21c1
Sequence:CCGGTGCATCAAGATAGTCACTTTACTCGAGTAAAGTGACTATCTTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182594
ZNF454 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 454
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-514s1c1
Sequence:CCGGCTGTCTTGACTGGATGACTATCTCGAGATAGTCATCCAGTCAAGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1134s1c1
Sequence:CCGGCCCATCATCATAGAATACATACTCGAGTATGTATTCTATGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1118s1c1
Sequence:CCGGCGAAATATACACCTTGCCCATCTCGAGATGGGCAAGGTGTATATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-1213s1c1
Sequence:CCGGCCTTACCAAACACCAGAATATCTCGAGATATTCTGGTGTTTGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182594.1-776s1c1
Sequence:CCGGCAGGGATTTCAACCTAGCAAACTCGAGTTTGCTAGGTTGAAATCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182594.1-1871s21c1
Sequence:CCGGAGACTGAGTAGATGAATTATTCTCGAGAATAATTCATCTACTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182594.1-1933s21c1
Sequence:CCGGTGCATCAAGATAGTCACTTTACTCGAGTAAAGTGACTATCTTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks