EMAIL THIS PAGE TO A FRIEND

ZNF45

zinc finger protein 45

Synonyms: KOX5 ZNF13
UniProtKB ID: Q02386, P17016, P78472, Q9P1U9
Gene ID:
Domestic Rabbit(100352117) zinc finger protein 45
naked mole-rat(101711431) zinc finger protein 45
cow(540342) zinc finger protein 45
sheep(101109474) zinc finger protein 45
dog(484463) zinc finger protein 45
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003425 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121581 MISSION® esiRNA esiRNA human ZNF45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003425 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129986 predicted 1959
2 SASI_Hs01_00129987 predicted 619
3 SASI_Hs01_00129988 predicted 672
4 SASI_Hs01_00129989 predicted 1218
5 SASI_Hs01_00129990 predicted 1806
6 SASI_Hs01_00129991 predicted 1843
7 SASI_Hs01_00129992 predicted 687
8 SASI_Hs01_00129993 predicted 1017
9 SASI_Hs01_00129994 predicted 1135
10 SASI_Hs01_00129995 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003425
VALIDATED
ZNF45 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 45
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-2920s1c1
Sequence:CCGGCGTGGACAAGTGTTTATCAAACTCGAGTTTGATAAACACTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003425.2-1389s1c1
Sequence:CCGGGCTCACACCTTAATATTCATTCTCGAGAATGAATATTAAGGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-682s1c1
Sequence:CCGGGCAACAGATTACAAGAGAGTTCTCGAGAACTCTCTTGTAATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003425.2-1805s1c1
Sequence:CCGGCGGAGCTCAGATCTTAATGTACTCGAGTACATTAAGATCTGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-772s1c1
Sequence:CCGGGCACTATAAAGATGAGGGATTCTCGAGAATCCCTCATCTTTATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003425.2-2920s21c1
Sequence:CCGGCGTGGACAAGTGTTTATCAAACTCGAGTTTGATAAACACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-1805s21c1
Sequence:CCGGCGGAGCTCAGATCTTAATGTACTCGAGTACATTAAGATCTGAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-1389s21c1
Sequence:CCGGGCTCACACCTTAATATTCATTCTCGAGAATGAATATTAAGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-682s21c1
Sequence:CCGGGCAACAGATTACAAGAGAGTTCTCGAGAACTCTCTTGTAATCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003425
VALIDATED
ZNF45 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 45
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-2920s1c1
Sequence:CCGGCGTGGACAAGTGTTTATCAAACTCGAGTTTGATAAACACTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003425.2-1389s1c1
Sequence:CCGGGCTCACACCTTAATATTCATTCTCGAGAATGAATATTAAGGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-682s1c1
Sequence:CCGGGCAACAGATTACAAGAGAGTTCTCGAGAACTCTCTTGTAATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003425.2-1805s1c1
Sequence:CCGGCGGAGCTCAGATCTTAATGTACTCGAGTACATTAAGATCTGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-772s1c1
Sequence:CCGGGCACTATAAAGATGAGGGATTCTCGAGAATCCCTCATCTTTATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003425.2-2920s21c1
Sequence:CCGGCGTGGACAAGTGTTTATCAAACTCGAGTTTGATAAACACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-1805s21c1
Sequence:CCGGCGGAGCTCAGATCTTAATGTACTCGAGTACATTAAGATCTGAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-1389s21c1
Sequence:CCGGGCTCACACCTTAATATTCATTCTCGAGAATGAATATTAAGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-682s21c1
Sequence:CCGGGCAACAGATTACAAGAGAGTTCTCGAGAACTCTCTTGTAATCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003425
VALIDATED
ZNF45 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 45
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-2920s1c1
Sequence:CCGGCGTGGACAAGTGTTTATCAAACTCGAGTTTGATAAACACTTGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003425.2-1389s1c1
Sequence:CCGGGCTCACACCTTAATATTCATTCTCGAGAATGAATATTAAGGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-682s1c1
Sequence:CCGGGCAACAGATTACAAGAGAGTTCTCGAGAACTCTCTTGTAATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003425.2-1805s1c1
Sequence:CCGGCGGAGCTCAGATCTTAATGTACTCGAGTACATTAAGATCTGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003425.2-772s1c1
Sequence:CCGGGCACTATAAAGATGAGGGATTCTCGAGAATCCCTCATCTTTATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003425.2-2920s21c1
Sequence:CCGGCGTGGACAAGTGTTTATCAAACTCGAGTTTGATAAACACTTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-1805s21c1
Sequence:CCGGCGGAGCTCAGATCTTAATGTACTCGAGTACATTAAGATCTGAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-1389s21c1
Sequence:CCGGGCTCACACCTTAATATTCATTCTCGAGAATGAATATTAAGGTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003425.2-682s21c1
Sequence:CCGGGCAACAGATTACAAGAGAGTTCTCGAGAACTCTCTTGTAATCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks