EMAIL THIS PAGE TO A FRIEND

ZNF460

zinc finger protein 460

Synonyms: HZF8 ZNF272
Species: Human ZNF460(10794)
UniProtKB ID: Q14592, A4FU64, Q2VPC7, Q6VSF8
Gene ID:
Human(10794) Summary: Zinc finger proteins, such as ZNF272, interact with nucleic acids and have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See ZFP93 (MIM 604749) for additional information on zinc finger proteins.[supplied by OMIM, May 2004]
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006635 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054961 MISSION® esiRNA esiRNA human ZNF460 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006635 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010821 predicted 1937
2 SASI_Hs01_00010823 predicted 986
3 SASI_Hs01_00010824 predicted 420
4 SASI_Hs01_00010825 predicted 842
5 SASI_Hs01_00010826 predicted 714
6 SASI_Hs01_00010827 predicted 1919
7 SASI_Hs01_00010828 predicted 781
8 SASI_Hs01_00010829 predicted 2048
9 SASI_Hs01_00010830 predicted 1177
10 SASI_Hs02_00341990 predicted 2059
11 SASI_Hs01_00010822 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006635
ZNF460 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 460
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1186s21c1
Sequence:CCGGCTTTACCTACCGCTCCAATTTCTCGAGAAATTGGAGCGGTAGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1939s21c1
Sequence:CCGGGCCTTCAATTGCCGCTCATTCCTCGAGGAATGAGCGGCAATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-571s21c1
Sequence:CCGGAGTCCCAAGATACTCCTATTTCTCGAGAAATAGGAGTATCTTGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1968s21c1
Sequence:CCGGTCGACATCAACGGATTCATAGCTCGAGCTATGAATCCGTTGATGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1833s1c1
Sequence:CCGGCCCAGTGAGTGCAGTGAATATCTCGAGATATTCACTGCACTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1625s1c1
Sequence:CCGGCAAACCTGATTCGACACTTTACTCGAGTAAAGTGTCGAATCAGGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1207s1c1
Sequence:CCGGGCCCTCATTCAACACTTCATTCTCGAGAATGAAGTGTTGAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-762s1c1
Sequence:CCGGCGAGGAAATGTTTAATGAGAACTCGAGTTCTCATTAAACATTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-632s1c1
Sequence:CCGGCGACAGCTGATGGTATTTGTTCTCGAGAACAAATACCATCAGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006635
ZNF460 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 460
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1186s21c1
Sequence:CCGGCTTTACCTACCGCTCCAATTTCTCGAGAAATTGGAGCGGTAGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1939s21c1
Sequence:CCGGGCCTTCAATTGCCGCTCATTCCTCGAGGAATGAGCGGCAATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-571s21c1
Sequence:CCGGAGTCCCAAGATACTCCTATTTCTCGAGAAATAGGAGTATCTTGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1968s21c1
Sequence:CCGGTCGACATCAACGGATTCATAGCTCGAGCTATGAATCCGTTGATGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1833s1c1
Sequence:CCGGCCCAGTGAGTGCAGTGAATATCTCGAGATATTCACTGCACTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1625s1c1
Sequence:CCGGCAAACCTGATTCGACACTTTACTCGAGTAAAGTGTCGAATCAGGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1207s1c1
Sequence:CCGGGCCCTCATTCAACACTTCATTCTCGAGAATGAAGTGTTGAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-762s1c1
Sequence:CCGGCGAGGAAATGTTTAATGAGAACTCGAGTTCTCATTAAACATTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-632s1c1
Sequence:CCGGCGACAGCTGATGGTATTTGTTCTCGAGAACAAATACCATCAGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006635
ZNF460 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 460
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1186s21c1
Sequence:CCGGCTTTACCTACCGCTCCAATTTCTCGAGAAATTGGAGCGGTAGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1939s21c1
Sequence:CCGGGCCTTCAATTGCCGCTCATTCCTCGAGGAATGAGCGGCAATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-571s21c1
Sequence:CCGGAGTCCCAAGATACTCCTATTTCTCGAGAAATAGGAGTATCTTGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006635.3-1968s21c1
Sequence:CCGGTCGACATCAACGGATTCATAGCTCGAGCTATGAATCCGTTGATGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1833s1c1
Sequence:CCGGCCCAGTGAGTGCAGTGAATATCTCGAGATATTCACTGCACTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1625s1c1
Sequence:CCGGCAAACCTGATTCGACACTTTACTCGAGTAAAGTGTCGAATCAGGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-1207s1c1
Sequence:CCGGGCCCTCATTCAACACTTCATTCTCGAGAATGAAGTGTTGAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-762s1c1
Sequence:CCGGCGAGGAAATGTTTAATGAGAACTCGAGTTCTCATTAAACATTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006635.1-632s1c1
Sequence:CCGGCGACAGCTGATGGTATTTGTTCTCGAGAACAAATACCATCAGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks