EMAIL THIS PAGE TO A FRIEND

ZNF461

zinc finger protein 461

Synonyms: GIOT-1 GIOT1
UniProtKB ID: Q8TAF7, A8K9W9, Q6VSF7, Q9ULZ8
Gene ID:
domestic cat(101096024) zinc finger protein 461
dog(100687631) zinc finger protein 461
cow(100296502) zinc finger protein 461
sheep(101108072) zinc finger protein 461
Domestic Rabbit(100357529) zinc finger protein 461
naked mole-rat(101721658) zinc finger protein 461
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153257 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032201 MISSION® esiRNA esiRNA human ZNF461 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153257 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241166 predicted 1740
2 SASI_Hs01_00241167 predicted 1909
3 SASI_Hs01_00241168 predicted 749
4 SASI_Hs01_00241169 predicted 1829
5 SASI_Hs01_00241170 predicted 853
6 SASI_Hs01_00241171 predicted 976
7 SASI_Hs01_00241175 predicted 982
8 SASI_Hs02_00367123 predicted 1813
9 SASI_Hs02_00367124 predicted 1254
10 SASI_Hs02_00367125 predicted 227
11 SASI_Hs01_00241172 predicted 1634
12 SASI_Hs01_00241173 predicted 914
13 SASI_Hs01_00241174 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153257
ZNF461 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 461
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1001s1c1
Sequence:CCGGGCTCACAACTTAAACATCTAACTCGAGTTAGATGTTTAAGTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-757s1c1
Sequence:CCGGCAACATACTTTACTCACTCAACTCGAGTTGAGTGAGTAAAGTATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1246s1c1
Sequence:CCGGCGTGGCTTTCAACTTACTGAACTCGAGTTCAGTAAGTTGAAAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1812s1c1
Sequence:CCGGGAAGGCGTTTAATCATAGATTCTCGAGAATCTATGATTAAACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-626s1c1
Sequence:CCGGGCCATAGTCCTGAGAGATCAACTCGAGTTGATCTCTCAGGACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153257.2-2385s21c1
Sequence:CCGGTTTCCAGGTCAGTACGTAAAGCTCGAGCTTTACGTACTGACCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153257
ZNF461 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 461
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1001s1c1
Sequence:CCGGGCTCACAACTTAAACATCTAACTCGAGTTAGATGTTTAAGTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-757s1c1
Sequence:CCGGCAACATACTTTACTCACTCAACTCGAGTTGAGTGAGTAAAGTATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1246s1c1
Sequence:CCGGCGTGGCTTTCAACTTACTGAACTCGAGTTCAGTAAGTTGAAAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1812s1c1
Sequence:CCGGGAAGGCGTTTAATCATAGATTCTCGAGAATCTATGATTAAACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-626s1c1
Sequence:CCGGGCCATAGTCCTGAGAGATCAACTCGAGTTGATCTCTCAGGACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153257.2-2385s21c1
Sequence:CCGGTTTCCAGGTCAGTACGTAAAGCTCGAGCTTTACGTACTGACCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153257
ZNF461 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 461
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1001s1c1
Sequence:CCGGGCTCACAACTTAAACATCTAACTCGAGTTAGATGTTTAAGTTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-757s1c1
Sequence:CCGGCAACATACTTTACTCACTCAACTCGAGTTGAGTGAGTAAAGTATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1246s1c1
Sequence:CCGGCGTGGCTTTCAACTTACTGAACTCGAGTTCAGTAAGTTGAAAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-1812s1c1
Sequence:CCGGGAAGGCGTTTAATCATAGATTCTCGAGAATCTATGATTAAACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153257.1-626s1c1
Sequence:CCGGGCCATAGTCCTGAGAGATCAACTCGAGTTGATCTCTCAGGACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153257.2-2385s21c1
Sequence:CCGGTTTCCAGGTCAGTACGTAAAGCTCGAGCTTTACGTACTGACCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks