EMAIL THIS PAGE TO A FRIEND

ZNF462

zinc finger protein 462

Synonyms: Zfp462
UniProtKB ID: Q96JM2, Q5T0T4, Q8N408
Gene ID:
naked mole-rat(101697845) zinc finger protein 462
Domestic Rabbit(100357282) zinc finger protein 462
domestic guinea pig(100723825) zinc finger protein 462
cow(515561) zinc finger protein 462
sheep(101102373) zinc finger protein 462
Zebrafish(335057) zinc finger protein 462
Zebrafish(100330769) zinc finger protein 462
domestic cat(101085160) zinc finger protein 462
dog(481655) zinc finger protein 462
chicken(431622) zinc finger protein 462
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA022283 Anti-ZNF462 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021224 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075921 MISSION® esiRNA esiRNA human ZNF462 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021224 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091015 predicted 2603
2 SASI_Hs01_00091018 predicted 4919
3 SASI_Hs02_00354837 predicted 4983
4 SASI_Hs02_00354838 predicted 2836
5 SASI_Hs01_00091021 predicted 6429
6 SASI_Hs02_00354839 predicted 3053
7 SASI_Hs01_00091022 predicted 6476
8 SASI_Hs01_00091023 predicted 7330
9 SASI_Hs01_00091024 predicted 1341
10 SASI_Hs02_00354840 predicted 818
11 SASI_Hs01_00091016 predicted 5021
12 SASI_Hs01_00091017 predicted 2885
13 SASI_Hs01_00091019 predicted 561
14 SASI_Hs01_00091020 predicted 3122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021224
VALIDATED
ZNF462 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 462
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-7755s21c1
Sequence:CCGGGTGTAGTAACTGCCGACAAATCTCGAGATTTGTCGGCAGTTACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-3144s21c1
Sequence:CCGGAGATCAACAACGCGATGATATCTCGAGATATCATCGCGTTGTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-4709s21c1
Sequence:CCGGGTATGCCAATCTGAGTATAACCTCGAGGTTATACTCAGATTGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021224.4-8140s21c1
Sequence:CCGGAGAAGCTCCATGACGGTAGAACTCGAGTTCTACCGTCATGGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021224.4-7925s21c1
Sequence:CCGGTTAGGACTGAACAATCTATTTCTCGAGAAATAGATTGTTCAGTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-6707s21c1
Sequence:CCGGGACTCCAATGACTCATCATATCTCGAGATATGATGAGTCATTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021224.3-8042s1c1
Sequence:CCGGCGGATCTTCATCATGGAAGTTCTCGAGAACTTCCATGATGAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021224.3-964s1c1
Sequence:CCGGGCGCAGCATCTTAGAGTCTATCTCGAGATAGACTCTAAGATGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-7087s1c1
Sequence:CCGGGCGCAACATGATTGACCACATCTCGAGATGTGGTCAATCATGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-3091s1c1
Sequence:CCGGCCCGAATGTTAGAAGCCTGATCTCGAGATCAGGCTTCTAACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-5445s1c1
Sequence:CCGGGCCACGACATTGATGCGTATTCTCGAGAATACGCATCAATGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021224
VALIDATED
ZNF462 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 462
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-7755s21c1
Sequence:CCGGGTGTAGTAACTGCCGACAAATCTCGAGATTTGTCGGCAGTTACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-3144s21c1
Sequence:CCGGAGATCAACAACGCGATGATATCTCGAGATATCATCGCGTTGTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-4709s21c1
Sequence:CCGGGTATGCCAATCTGAGTATAACCTCGAGGTTATACTCAGATTGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021224.4-8140s21c1
Sequence:CCGGAGAAGCTCCATGACGGTAGAACTCGAGTTCTACCGTCATGGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021224.4-7925s21c1
Sequence:CCGGTTAGGACTGAACAATCTATTTCTCGAGAAATAGATTGTTCAGTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-6707s21c1
Sequence:CCGGGACTCCAATGACTCATCATATCTCGAGATATGATGAGTCATTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021224.3-8042s1c1
Sequence:CCGGCGGATCTTCATCATGGAAGTTCTCGAGAACTTCCATGATGAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021224.3-964s1c1
Sequence:CCGGGCGCAGCATCTTAGAGTCTATCTCGAGATAGACTCTAAGATGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-7087s1c1
Sequence:CCGGGCGCAACATGATTGACCACATCTCGAGATGTGGTCAATCATGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-3091s1c1
Sequence:CCGGCCCGAATGTTAGAAGCCTGATCTCGAGATCAGGCTTCTAACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-5445s1c1
Sequence:CCGGGCCACGACATTGATGCGTATTCTCGAGAATACGCATCAATGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021224
VALIDATED
ZNF462 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 462
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-7755s21c1
Sequence:CCGGGTGTAGTAACTGCCGACAAATCTCGAGATTTGTCGGCAGTTACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-3144s21c1
Sequence:CCGGAGATCAACAACGCGATGATATCTCGAGATATCATCGCGTTGTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-4709s21c1
Sequence:CCGGGTATGCCAATCTGAGTATAACCTCGAGGTTATACTCAGATTGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021224.4-8140s21c1
Sequence:CCGGAGAAGCTCCATGACGGTAGAACTCGAGTTCTACCGTCATGGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021224.4-7925s21c1
Sequence:CCGGTTAGGACTGAACAATCTATTTCTCGAGAAATAGATTGTTCAGTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021224.4-6707s21c1
Sequence:CCGGGACTCCAATGACTCATCATATCTCGAGATATGATGAGTCATTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021224.3-8042s1c1
Sequence:CCGGCGGATCTTCATCATGGAAGTTCTCGAGAACTTCCATGATGAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021224.3-964s1c1
Sequence:CCGGGCGCAGCATCTTAGAGTCTATCTCGAGATAGACTCTAAGATGCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-7087s1c1
Sequence:CCGGGCGCAACATGATTGACCACATCTCGAGATGTGGTCAATCATGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-3091s1c1
Sequence:CCGGCCCGAATGTTAGAAGCCTGATCTCGAGATCAGGCTTCTAACATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021224.3-5445s1c1
Sequence:CCGGGCCACGACATTGATGCGTATTCTCGAGAATACGCATCAATGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks