EMAIL THIS PAGE TO A FRIEND

ZNF467

zinc finger protein 467

Synonyms: EZI Zfp467
UniProtKB ID: Q7Z7K2
Gene ID:
chicken(776370) zinc finger protein 467
dog(482787) zinc finger protein 467
domestic cat(101092596) zinc finger protein 467
cow(527301) zinc finger protein 467
sheep(101108650) zinc finger protein 467
domestic guinea pig(100735461) zinc finger protein 467
naked mole-rat(101722724) zinc finger protein 467
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207336 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018204 predicted 405
2 SASI_Hs01_00018205 predicted 517
3 SASI_Hs01_00018206 predicted 1944
4 SASI_Hs01_00018207 predicted 1141
5 SASI_Hs01_00018208 predicted 2041
6 SASI_Hs01_00018209 predicted 1778
7 SASI_Hs01_00018210 predicted 1057
8 SASI_Hs01_00018212 predicted 567
9 SASI_Hs01_00018213 predicted 445
10 SASI_Hs02_00373889 predicted 979
11 SASI_Hs01_00018211 predicted 1592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376717
ZNF467 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 467
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376717.1-2061s1c1
Sequence:CCGGACCCTTTCTTGCCCACAGTTTCTCGAGAAACTGTGGGCAAGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-78s1c1
Sequence:CCGGGCTGTCAGTCTGTCAGTCTTTCTCGAGAAAGACTGACAGACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-1099s1c1
Sequence:CCGGCGCAAGAAGACGCACTTGATTCTCGAGAATCAAGTGCGTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-525s1c1
Sequence:CCGGGTGGATGATTCGGAAGGTGAACTCGAGTTCACCTTCCGAATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-1098s1c1
Sequence:CCGGTCGCAAGAAGACGCACTTGATCTCGAGATCAAGTGCGTCTTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376717
ZNF467 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 467
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376717.1-2061s1c1
Sequence:CCGGACCCTTTCTTGCCCACAGTTTCTCGAGAAACTGTGGGCAAGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-78s1c1
Sequence:CCGGGCTGTCAGTCTGTCAGTCTTTCTCGAGAAAGACTGACAGACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-1099s1c1
Sequence:CCGGCGCAAGAAGACGCACTTGATTCTCGAGAATCAAGTGCGTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-525s1c1
Sequence:CCGGGTGGATGATTCGGAAGGTGAACTCGAGTTCACCTTCCGAATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-1098s1c1
Sequence:CCGGTCGCAAGAAGACGCACTTGATCTCGAGATCAAGTGCGTCTTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376717
ZNF467 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 467
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376717.1-2061s1c1
Sequence:CCGGACCCTTTCTTGCCCACAGTTTCTCGAGAAACTGTGGGCAAGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-78s1c1
Sequence:CCGGGCTGTCAGTCTGTCAGTCTTTCTCGAGAAAGACTGACAGACTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-1099s1c1
Sequence:CCGGCGCAAGAAGACGCACTTGATTCTCGAGAATCAAGTGCGTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-525s1c1
Sequence:CCGGGTGGATGATTCGGAAGGTGAACTCGAGTTCACCTTCCGAATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376717.1-1098s1c1
Sequence:CCGGTCGCAAGAAGACGCACTTGATCTCGAGATCAAGTGCGTCTTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks