EMAIL THIS PAGE TO A FRIEND

ZNF468

zinc finger protein 468

Species: Human ZNF468(90333)
UniProtKB ID: Q5VIY5, A8MV20, Q5CZB8, Q5VIY4, Q68DI7
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400760 Anti-ZNF468 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2104332 Anti-ZNF468 antibody produced in rabbit affinity isolated antibody bovine, canine, zebrafish, horse, rabbit, human, mouse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199132 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008801 Rosetta Predictions human pricing
NM_199132 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057263 predicted 1752
2 SASI_Hs01_00057264 predicted 1797
3 SASI_Hs01_00057265 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014120 predicted 1871
2 SASI_Hs01_00014121 predicted 1911
3 SASI_Hs01_00014122 predicted 525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199132
ZNF468 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 468
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1099s1c1
Sequence:CCGGGCAAGACCTTTGGTCATAATTCTCGAGAATTATGACCAAAGGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199132.1-2878s1c1
Sequence:CCGGGCAAAGCGTTTACTTCACATTCTCGAGAATGTGAAGTAAACGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-1266s1c1
Sequence:CCGGGATGAGGCTTTCGCATATAATCTCGAGATTATATGCGAAAGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199132.1-2734s1c1
Sequence:CCGGGCCTTGCATTTCACTGGTGAACTCGAGTTCACCAGTGAAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1380s1c1
Sequence:CCGGGCACGCCATCATAGACTTCATCTCGAGATGAAGTCTATGATGGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-1140s1c1
Sequence:CCGGGCGCTTCATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-784s1c1
Sequence:CCGGCCTCAGTTTCAACATCCCAAACTCGAGTTTGGGATGTTGAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1632s1c1
Sequence:CCGGGCACAACATCAGAGAGTTCATCTCGAGATGAACTCTCTGATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1591s1c1
Sequence:CCGGGTAAGGTTTGTGACAAGGCTTCTCGAGAAGCCTTGTCACAAACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199132.1-3034s1c1
Sequence:CCGGGCAGTGAGTATAGCAAACCATCTCGAGATGGTTTGCTATACTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1783s1c1
Sequence:CCGGGTCAGATGTCATCCCTTGTATCTCGAGATACAAGGGATGACATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-455s1c1
Sequence:CCGGGCAAGGCAATACAGAAGTGATCTCGAGATCACTTCTGTATTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199132
ZNF468 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 468
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1099s1c1
Sequence:CCGGGCAAGACCTTTGGTCATAATTCTCGAGAATTATGACCAAAGGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199132.1-2878s1c1
Sequence:CCGGGCAAAGCGTTTACTTCACATTCTCGAGAATGTGAAGTAAACGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-1266s1c1
Sequence:CCGGGATGAGGCTTTCGCATATAATCTCGAGATTATATGCGAAAGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199132.1-2734s1c1
Sequence:CCGGGCCTTGCATTTCACTGGTGAACTCGAGTTCACCAGTGAAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1380s1c1
Sequence:CCGGGCACGCCATCATAGACTTCATCTCGAGATGAAGTCTATGATGGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-1140s1c1
Sequence:CCGGGCGCTTCATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-784s1c1
Sequence:CCGGCCTCAGTTTCAACATCCCAAACTCGAGTTTGGGATGTTGAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1632s1c1
Sequence:CCGGGCACAACATCAGAGAGTTCATCTCGAGATGAACTCTCTGATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1591s1c1
Sequence:CCGGGTAAGGTTTGTGACAAGGCTTCTCGAGAAGCCTTGTCACAAACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199132.1-3034s1c1
Sequence:CCGGGCAGTGAGTATAGCAAACCATCTCGAGATGGTTTGCTATACTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1783s1c1
Sequence:CCGGGTCAGATGTCATCCCTTGTATCTCGAGATACAAGGGATGACATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-455s1c1
Sequence:CCGGGCAAGGCAATACAGAAGTGATCTCGAGATCACTTCTGTATTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199132
ZNF468 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 468
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1099s1c1
Sequence:CCGGGCAAGACCTTTGGTCATAATTCTCGAGAATTATGACCAAAGGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199132.1-2878s1c1
Sequence:CCGGGCAAAGCGTTTACTTCACATTCTCGAGAATGTGAAGTAAACGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-1266s1c1
Sequence:CCGGGATGAGGCTTTCGCATATAATCTCGAGATTATATGCGAAAGCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199132.1-2734s1c1
Sequence:CCGGGCCTTGCATTTCACTGGTGAACTCGAGTTCACCAGTGAAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1380s1c1
Sequence:CCGGGCACGCCATCATAGACTTCATCTCGAGATGAAGTCTATGATGGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-1140s1c1
Sequence:CCGGGCGCTTCATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199132.1-784s1c1
Sequence:CCGGCCTCAGTTTCAACATCCCAAACTCGAGTTTGGGATGTTGAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1632s1c1
Sequence:CCGGGCACAACATCAGAGAGTTCATCTCGAGATGAACTCTCTGATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1591s1c1
Sequence:CCGGGTAAGGTTTGTGACAAGGCTTCTCGAGAAGCCTTGTCACAAACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199132.1-3034s1c1
Sequence:CCGGGCAGTGAGTATAGCAAACCATCTCGAGATGGTTTGCTATACTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-1783s1c1
Sequence:CCGGGTCAGATGTCATCCCTTGTATCTCGAGATACAAGGGATGACATCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199132.1-455s1c1
Sequence:CCGGGCAAGGCAATACAGAAGTGATCTCGAGATCACTTCTGTATTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks