EMAIL THIS PAGE TO A FRIEND

ZNF469

zinc finger protein 469

Synonyms: BCS
UniProtKB ID: Q96JG9
Gene ID:
Human(84627) Summary: This gene encodes a zinc-finger protein. Low-percent homology to certain collagens suggests that it may function as a transcription factor or extra-nuclear regulator factor for the synthesis or organization of collagen fibers. Mutations in this gene cause brittle cornea syndrome. [provided by RefSeq, Jul 2008]
chicken(101748749) zinc finger protein 469
domestic cat(101096690) zinc finger protein 469
dog(489666) zinc finger protein 469
naked mole-rat(101710656) zinc finger protein 469
domestic guinea pig(101788635) zinc finger protein 469
cow(100298623) zinc finger protein 469
sheep(101106028) zinc finger protein 469
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA069784 Anti-ZNF469 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127464 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223161 MISSION® esiRNA esiRNA targeting human ZNF469 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127464 Rosetta Predictions human pricing
XM_040592 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329624 predicted 1638
2 SASI_Hs02_00329625 predicted 11751
3 SASI_Hs02_00329626 predicted 11762
4 SASI_Hs02_00329627 predicted 4607
5 SASI_Hs02_00329628 predicted 6894
6 SASI_Hs02_00329629 predicted 8986
7 SASI_Hs02_00329630 predicted 6315
8 SASI_Hs02_00329631 predicted 2842
9 SASI_Hs02_00329632 predicted 9066
10 SASI_Hs02_00329633 predicted 8587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_040592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248286 predicted 7430
2 SASI_Hs01_00248287 predicted 10102
3 SASI_Hs01_00248288 predicted 3497
4 SASI_Hs01_00248289 predicted 10118
5 SASI_Hs01_00248290 predicted 2963
6 SASI_Hs01_00248291 predicted 5249
7 SASI_Hs01_00248292 predicted 7338
8 SASI_Hs01_00248293 predicted 5938
9 SASI_Hs01_00248294 predicted 1404
10 SASI_Hs01_00248295 predicted 7418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127464
ZNF469 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 469
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-723s21c1
Sequence:CCGGTAGCTTCCCAGGTGCTAATTTCTCGAGAAATTAGCACCTGGGAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-569s21c1
Sequence:CCGGGCTTTACCTCCACCAACTATACTCGAGTATAGTTGGTGGAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127464.1-12563s21c1
Sequence:CCGGTCCGCCTATTTGCAATGTTACCTCGAGGTAACATTGCAAATAGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-5143s21c1
Sequence:CCGGCCCGACCAGGAACTTTCATTTCTCGAGAAATGAAAGTTCCTGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-7251s21c1
Sequence:CCGGACAGAGGTCCCGTGGCTATAACTCGAGTTATAGCCACGGGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127464
ZNF469 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 469
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-723s21c1
Sequence:CCGGTAGCTTCCCAGGTGCTAATTTCTCGAGAAATTAGCACCTGGGAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-569s21c1
Sequence:CCGGGCTTTACCTCCACCAACTATACTCGAGTATAGTTGGTGGAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127464.1-12563s21c1
Sequence:CCGGTCCGCCTATTTGCAATGTTACCTCGAGGTAACATTGCAAATAGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-5143s21c1
Sequence:CCGGCCCGACCAGGAACTTTCATTTCTCGAGAAATGAAAGTTCCTGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-7251s21c1
Sequence:CCGGACAGAGGTCCCGTGGCTATAACTCGAGTTATAGCCACGGGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127464
ZNF469 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 469
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-723s21c1
Sequence:CCGGTAGCTTCCCAGGTGCTAATTTCTCGAGAAATTAGCACCTGGGAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-569s21c1
Sequence:CCGGGCTTTACCTCCACCAACTATACTCGAGTATAGTTGGTGGAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127464.1-12563s21c1
Sequence:CCGGTCCGCCTATTTGCAATGTTACCTCGAGGTAACATTGCAAATAGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-5143s21c1
Sequence:CCGGCCCGACCAGGAACTTTCATTTCTCGAGAAATGAAAGTTCCTGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127464.1-7251s21c1
Sequence:CCGGACAGAGGTCCCGTGGCTATAACTCGAGTTATAGCCACGGGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks