EMAIL THIS PAGE TO A FRIEND

ZNF470

zinc finger protein 470

Synonyms: CZF-1
UniProtKB ID: Q6ECI4, A8MTW0, B9EGU1, Q6ZPA1, Q9Y2N9
Gene ID:
cow(444866) zinc finger protein 470
sheep(101106708) zinc finger protein 470
naked mole-rat(101713444) zinc finger protein 470
Domestic Rabbit(100345038) zinc finger protein 470
Horse(100058177) zinc finger protein 470
domestic cat(101095388) zinc finger protein 470
dog(612850) zinc finger protein 470
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029000 Anti-ZNF470 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001668 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001668 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137331 predicted 1153
2 SASI_Hs01_00137333 predicted 2022
3 SASI_Hs01_00137334 predicted 1212
4 SASI_Hs01_00137335 predicted 1803
5 SASI_Hs01_00137336 predicted 1053
6 SASI_Hs01_00137338 predicted 1555
7 SASI_Hs01_00137337 predicted 1900
8 SASI_Hs01_00137340 predicted 1249
9 SASI_Hs02_00303865 predicted 991
10 SASI_Hs02_00303866 predicted 1141
11 SASI_Hs01_00137332 predicted 375
12 SASI_Hs01_00137339 predicted 1317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001668
ZNF470 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 470
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-397s1c1
Sequence:CCGGCCAGGAGAGAAACCCTATGAACTCGAGTTCATAGGGTTTCTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1341s1c1
Sequence:CCGGCGAATGTATTGAATGTGGGAACTCGAGTTCCCACATTCAATACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-171s1c1
Sequence:CCGGGAACCTAGTTTCAGTGGGTAACTCGAGTTACCCACTGAAACTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-1510s1c1
Sequence:CCGGGAATGTAATGTTTGTGGGAAACTCGAGTTTCCCACAAACATTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-239s1c1
Sequence:CCGGCCATTATCAGAATTTCCCATACTCGAGTATGGGAAATTCTGATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1466s1c1
Sequence:CCGGCCTTGATTTGTCATCAGAGATCTCGAGATCTCTGATGACAAATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-910s1c1
Sequence:CCGGGAGAGACCTTACAAATGTAATCTCGAGATTACATTTGTAAGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1006s1c1
Sequence:CCGGGAATGCAATATCTGTGAGAAACTCGAGTTTCTCACAGATATTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-301s1c1
Sequence:CCGGGCAGGTCTTTGCATTTCTAAACTCGAGTTTAGAAATGCAAAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001668
ZNF470 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 470
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-397s1c1
Sequence:CCGGCCAGGAGAGAAACCCTATGAACTCGAGTTCATAGGGTTTCTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1341s1c1
Sequence:CCGGCGAATGTATTGAATGTGGGAACTCGAGTTCCCACATTCAATACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-171s1c1
Sequence:CCGGGAACCTAGTTTCAGTGGGTAACTCGAGTTACCCACTGAAACTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-1510s1c1
Sequence:CCGGGAATGTAATGTTTGTGGGAAACTCGAGTTTCCCACAAACATTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-239s1c1
Sequence:CCGGCCATTATCAGAATTTCCCATACTCGAGTATGGGAAATTCTGATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1466s1c1
Sequence:CCGGCCTTGATTTGTCATCAGAGATCTCGAGATCTCTGATGACAAATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-910s1c1
Sequence:CCGGGAGAGACCTTACAAATGTAATCTCGAGATTACATTTGTAAGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1006s1c1
Sequence:CCGGGAATGCAATATCTGTGAGAAACTCGAGTTTCTCACAGATATTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-301s1c1
Sequence:CCGGGCAGGTCTTTGCATTTCTAAACTCGAGTTTAGAAATGCAAAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001668
ZNF470 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 470
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-397s1c1
Sequence:CCGGCCAGGAGAGAAACCCTATGAACTCGAGTTCATAGGGTTTCTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1341s1c1
Sequence:CCGGCGAATGTATTGAATGTGGGAACTCGAGTTCCCACATTCAATACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-171s1c1
Sequence:CCGGGAACCTAGTTTCAGTGGGTAACTCGAGTTACCCACTGAAACTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-1510s1c1
Sequence:CCGGGAATGTAATGTTTGTGGGAAACTCGAGTTTCCCACAAACATTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001668.1-239s1c1
Sequence:CCGGCCATTATCAGAATTTCCCATACTCGAGTATGGGAAATTCTGATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1466s1c1
Sequence:CCGGCCTTGATTTGTCATCAGAGATCTCGAGATCTCTGATGACAAATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-910s1c1
Sequence:CCGGGAGAGACCTTACAAATGTAATCTCGAGATTACATTTGTAAGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-1006s1c1
Sequence:CCGGGAATGCAATATCTGTGAGAAACTCGAGTTTCTCACAGATATTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001668.1-301s1c1
Sequence:CCGGGCAGGTCTTTGCATTTCTAAACTCGAGTTTAGAAATGCAAAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks