EMAIL THIS PAGE TO A FRIEND

ZNF471

zinc finger protein 471

Synonyms: ERP1 Z1971
UniProtKB ID: Q9BX82, O75260, Q08AD6, Q08AD7, Q8N3V1, Q9P2F1
Gene ID:
domestic cat(101101602) zinc finger protein 471
dog(484278) zinc finger protein 471
Domestic Rabbit(100344528) zinc finger protein 471
cow(787287) zinc finger protein 471
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020813 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048001 MISSION® esiRNA esiRNA human ZNF471 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020813 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067804 predicted 647
2 SASI_Hs02_00354007 predicted 301
3 SASI_Hs01_00067806 predicted 1527
4 SASI_Hs01_00067807 predicted 1704
5 SASI_Hs01_00067808 predicted 618
6 SASI_Hs01_00067809 predicted 582
7 SASI_Hs01_00067810 predicted 1225
8 SASI_Hs02_00354008 predicted 1687
9 SASI_Hs01_00067811 predicted 585
10 SASI_Hs01_00067812 predicted 364
11 SASI_Hs01_00067805 predicted 382
12 SASI_Hs01_00067813 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020813
ZNF471 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 471
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-378s1c1
Sequence:CCGGGCCCATTCTCAGATTGGGAATCTCGAGATTCCCAATCTGAGAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1800s1c1
Sequence:CCGGCCAATCTTACTCAACATCAAACTCGAGTTTGATGTTGAGTAAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1276s1c1
Sequence:CCGGGAAAGCCTTCAGTGTTCACATCTCGAGATGTGAACACTGAAGGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-241s1c1
Sequence:CCGGGCGTTTATACAGGAGTATGATCTCGAGATCATACTCCTGTATAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1948s1c1
Sequence:CCGGGAAGGCGTTCAGAAGAAAGTTCTCGAGAACTTTCTTCTGAACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020813.2-1218s21c1
Sequence:CCGGTTCGTCACTGGAGGAGTTATCCTCGAGGATAACTCCTCCAGTGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020813
ZNF471 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 471
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-378s1c1
Sequence:CCGGGCCCATTCTCAGATTGGGAATCTCGAGATTCCCAATCTGAGAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1800s1c1
Sequence:CCGGCCAATCTTACTCAACATCAAACTCGAGTTTGATGTTGAGTAAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1276s1c1
Sequence:CCGGGAAAGCCTTCAGTGTTCACATCTCGAGATGTGAACACTGAAGGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-241s1c1
Sequence:CCGGGCGTTTATACAGGAGTATGATCTCGAGATCATACTCCTGTATAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1948s1c1
Sequence:CCGGGAAGGCGTTCAGAAGAAAGTTCTCGAGAACTTTCTTCTGAACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020813.2-1218s21c1
Sequence:CCGGTTCGTCACTGGAGGAGTTATCCTCGAGGATAACTCCTCCAGTGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020813
ZNF471 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 471
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-378s1c1
Sequence:CCGGGCCCATTCTCAGATTGGGAATCTCGAGATTCCCAATCTGAGAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1800s1c1
Sequence:CCGGCCAATCTTACTCAACATCAAACTCGAGTTTGATGTTGAGTAAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1276s1c1
Sequence:CCGGGAAAGCCTTCAGTGTTCACATCTCGAGATGTGAACACTGAAGGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-241s1c1
Sequence:CCGGGCGTTTATACAGGAGTATGATCTCGAGATCATACTCCTGTATAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020813.1-1948s1c1
Sequence:CCGGGAAGGCGTTCAGAAGAAAGTTCTCGAGAACTTTCTTCTGAACGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020813.2-1218s21c1
Sequence:CCGGTTCGTCACTGGAGGAGTTATCCTCGAGGATAACTCCTCCAGTGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks