EMAIL THIS PAGE TO A FRIEND

ZNF473

zinc finger protein 473

Synonyms: HZFP100 ZN473
UniProtKB ID: Q8WTR7, A8K8T7, Q9ULS9, Q9Y4Q7
Gene ID:
cow(784785) zinc finger protein 473
sheep(101115478) zinc finger protein 473
naked mole-rat(101705265) zinc finger protein 473
domestic guinea pig(100720946) zinc finger protein 473
domestic cat(101100169) zinc finger protein 473
Horse(100056907) zinc finger protein 473
dog(100688468) zinc finger protein 473
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006656 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032261 MISSION® esiRNA esiRNA human ZNF473 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006656 Rosetta Predictions human pricing
NM_015428 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152239 predicted 2547
2 SASI_Hs01_00152240 predicted 2756
3 SASI_Hs01_00152241 predicted 2071
4 SASI_Hs01_00152242 predicted 2673
5 SASI_Hs02_00305118 predicted 1832
6 SASI_Hs01_00152243 predicted 726
7 SASI_Hs02_00305119 predicted 1011
8 SASI_Hs01_00152245 predicted 1580
9 SASI_Hs01_00152246 predicted 596
10 SASI_Hs01_00152247 predicted 1945
11 SASI_Hs01_00152244 predicted 668
12 SASI_Hs01_00152248 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168122 predicted 2674
2 SASI_Hs01_00168123 predicted 2875
3 SASI_Hs01_00168124 predicted 2190
4 SASI_Hs01_00168125 predicted 2787
5 SASI_Hs02_00347812 predicted 1957
6 SASI_Hs01_00168127 predicted 845
7 SASI_Hs02_00347813 predicted 1133
8 SASI_Hs01_00168129 predicted 1707
9 SASI_Hs01_00168130 predicted 711
10 SASI_Hs01_00168131 predicted 2060
11 SASI_Hs01_00168126 predicted 1756
12 SASI_Hs01_00168128 predicted 800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006656
VALIDATED
ZNF473 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 473
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-3587s21c1
Sequence:CCGGCTATGACCTTCCTCCATTTAACTCGAGTTAAATGGAGGAAGGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-1793s21c1
Sequence:CCGGAGTGCGGAGAACGCTTCATTTCTCGAGAAATGAAGCGTTCTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-1713s21c1
Sequence:CCGGCAAGGAGACTTTCAGCGATAACTCGAGTTATCGCTGAAAGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006656.1-1558s21c1
Sequence:CCGGCACCGGCACACTCACCTTAATCTCGAGATTAAGGTGAGTGTGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006656.1-515s21c1
Sequence:CCGGGATTCTCCCAGGAGATTATAGCTCGAGCTATAATCTCCTGGGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006656.1-3841s1c1
Sequence:CCGGGCGGGTAGTATCCATACACTACTCGAGTAGTGTATGGATACTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001006656.1-1019s1c1
Sequence:CCGGGCTACAAATTCTATGTGTGTACTCGAGTACACACATAGAATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-2554s1c1
Sequence:CCGGCTTTCTATTCACCGGAGAGTTCTCGAGAACTCTCCGGTGAATAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-1405s1c1
Sequence:CCGGCTCATTGAACACCAGGCTCTTCTCGAGAAGAGCCTGGTGTTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-1476s1c1
Sequence:CCGGGCATAACTCTACCCTAAAGATCTCGAGATCTTTAGGGTAGAGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006656
VALIDATED
ZNF473 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 473
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-3587s21c1
Sequence:CCGGCTATGACCTTCCTCCATTTAACTCGAGTTAAATGGAGGAAGGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-1793s21c1
Sequence:CCGGAGTGCGGAGAACGCTTCATTTCTCGAGAAATGAAGCGTTCTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-1713s21c1
Sequence:CCGGCAAGGAGACTTTCAGCGATAACTCGAGTTATCGCTGAAAGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006656.1-1558s21c1
Sequence:CCGGCACCGGCACACTCACCTTAATCTCGAGATTAAGGTGAGTGTGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006656.1-515s21c1
Sequence:CCGGGATTCTCCCAGGAGATTATAGCTCGAGCTATAATCTCCTGGGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006656.1-3841s1c1
Sequence:CCGGGCGGGTAGTATCCATACACTACTCGAGTAGTGTATGGATACTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001006656.1-1019s1c1
Sequence:CCGGGCTACAAATTCTATGTGTGTACTCGAGTACACACATAGAATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-2554s1c1
Sequence:CCGGCTTTCTATTCACCGGAGAGTTCTCGAGAACTCTCCGGTGAATAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-1405s1c1
Sequence:CCGGCTCATTGAACACCAGGCTCTTCTCGAGAAGAGCCTGGTGTTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-1476s1c1
Sequence:CCGGGCATAACTCTACCCTAAAGATCTCGAGATCTTTAGGGTAGAGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006656
VALIDATED
ZNF473 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 473
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-3587s21c1
Sequence:CCGGCTATGACCTTCCTCCATTTAACTCGAGTTAAATGGAGGAAGGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-1793s21c1
Sequence:CCGGAGTGCGGAGAACGCTTCATTTCTCGAGAAATGAAGCGTTCTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001006656.1-1713s21c1
Sequence:CCGGCAAGGAGACTTTCAGCGATAACTCGAGTTATCGCTGAAAGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006656.1-1558s21c1
Sequence:CCGGCACCGGCACACTCACCTTAATCTCGAGATTAAGGTGAGTGTGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006656.1-515s21c1
Sequence:CCGGGATTCTCCCAGGAGATTATAGCTCGAGCTATAATCTCCTGGGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006656.1-3841s1c1
Sequence:CCGGGCGGGTAGTATCCATACACTACTCGAGTAGTGTATGGATACTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001006656.1-1019s1c1
Sequence:CCGGGCTACAAATTCTATGTGTGTACTCGAGTACACACATAGAATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-2554s1c1
Sequence:CCGGCTTTCTATTCACCGGAGAGTTCTCGAGAACTCTCCGGTGAATAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-1405s1c1
Sequence:CCGGCTCATTGAACACCAGGCTCTTCTCGAGAAGAGCCTGGTGTTCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006656.1-1476s1c1
Sequence:CCGGGCATAACTCTACCCTAAAGATCTCGAGATCTTTAGGGTAGAGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks