EMAIL THIS PAGE TO A FRIEND

ZNF474

zinc finger protein 474

UniProtKB ID: Q6S9Z5, A8K4M0, Q96M07
Gene ID:
dog(474655) zinc finger protein 474-like
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207317 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054991 MISSION® esiRNA esiRNA human ZNF474 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207317 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024044 predicted 662
2 SASI_Hs01_00024046 predicted 588
3 SASI_Hs01_00024047 predicted 1561
4 SASI_Hs01_00024048 predicted 682
5 SASI_Hs01_00024049 predicted 891
6 SASI_Hs01_00024050 predicted 1393
7 SASI_Hs01_00024051 predicted 444
8 SASI_Hs01_00024052 predicted 741
9 SASI_Hs02_00373859 predicted 397
10 SASI_Hs01_00024053 predicted 993
11 SASI_Hs01_00024045 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207317
ZNF474 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 474
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-830s1c1
Sequence:CCGGGCAACTAACGAGGCTGCATTTCTCGAGAAATGCAGCCTCGTTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207317.1-1650s1c1
Sequence:CCGGCCTCTTCAATTCTGCTGTCTACTCGAGTAGACAGCAGAATTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-1421s1c1
Sequence:CCGGCATGCCACACAAGACGCATTACTCGAGTAATGCGTCTTGTGTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-893s1c1
Sequence:CCGGCGCACATTCTTGCCAGATCATCTCGAGATGATCTGGCAAGAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207317.1-1788s1c1
Sequence:CCGGCCATTCCAACAGCCAATATTTCTCGAGAAATATTGGCTGTTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207317
ZNF474 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 474
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-830s1c1
Sequence:CCGGGCAACTAACGAGGCTGCATTTCTCGAGAAATGCAGCCTCGTTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207317.1-1650s1c1
Sequence:CCGGCCTCTTCAATTCTGCTGTCTACTCGAGTAGACAGCAGAATTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-1421s1c1
Sequence:CCGGCATGCCACACAAGACGCATTACTCGAGTAATGCGTCTTGTGTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-893s1c1
Sequence:CCGGCGCACATTCTTGCCAGATCATCTCGAGATGATCTGGCAAGAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207317.1-1788s1c1
Sequence:CCGGCCATTCCAACAGCCAATATTTCTCGAGAAATATTGGCTGTTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207317
ZNF474 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 474
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-830s1c1
Sequence:CCGGGCAACTAACGAGGCTGCATTTCTCGAGAAATGCAGCCTCGTTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207317.1-1650s1c1
Sequence:CCGGCCTCTTCAATTCTGCTGTCTACTCGAGTAGACAGCAGAATTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-1421s1c1
Sequence:CCGGCATGCCACACAAGACGCATTACTCGAGTAATGCGTCTTGTGTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207317.1-893s1c1
Sequence:CCGGCGCACATTCTTGCCAGATCATCTCGAGATGATCTGGCAAGAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207317.1-1788s1c1
Sequence:CCGGCCATTCCAACAGCCAATATTTCTCGAGAAATATTGGCTGTTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks