EMAIL THIS PAGE TO A FRIEND

ZNF479

zinc finger protein 479

Synonyms: KR19
Species: Human ZNF479(90827)
UniProtKB ID: Q96JC4
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302261 ANTI-ZNF479 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033273 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033273 Rosetta Predictions human pricing
XM_001714591 Rosetta Predictions human pricing
XM_001719979 Rosetta Predictions human pricing
XM_925790 Rosetta Predictions human pricing
XM_930601 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361067 predicted 1517
2 SASI_Hs02_00361068 predicted 1174
3 SASI_Hs02_00361069 predicted 1354
4 SASI_Hs02_00361070 predicted 661
5 SASI_Hs02_00361071 predicted 1016
6 SASI_Hs02_00361072 predicted 530
7 SASI_Hs02_00361073 predicted 688
8 SASI_Hs02_00361074 predicted 1447
9 SASI_Hs02_00361075 predicted 688
10 SASI_Hs02_00361076 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398132 predicted 620
2 SASI_Hs02_00398133 predicted 611
3 SASI_Hs02_00398134 predicted 529
4 SASI_Hs02_00398135 predicted 610
5 SASI_Hs02_00398136 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433823 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265946 predicted 1357
2 SASI_Hs01_00265947 predicted 1009
3 SASI_Hs01_00265948 predicted 658
4 SASI_Hs01_00265949 predicted 526
5 SASI_Hs01_00265950 predicted 679
6 SASI_Hs01_00265951 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272278 predicted 1050
2 SASI_Hs01_00272279 predicted 716
3 SASI_Hs01_00272280 predicted 359
4 SASI_Hs01_00272281 predicted 386
5 SASI_Hs01_00272282 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033273
ZNF479 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 479
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1016s21c1
Sequence:CCGGGCCTTTAGCTGGTCTGCAAACCTCGAGGTTTGCAGACCAGCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1024s21c1
Sequence:CCGGCTGGTCTGCAAACCTTACTAGCTCGAGCTAGTAAGGTTTGCAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1366s21c1
Sequence:CCGGCTCGAACCTTATGAGACATAGCTCGAGCTATGTCTCATAAGGTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1357s21c1
Sequence:CCGGTAGCTTATCCTCGAACCTTATCTCGAGATAAGGTTCGAGGATAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033273.1-1857s21c1
Sequence:CCGGTCCACCCTCAGGCCTTATAATCTCGAGATTATAAGGCCTGAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033273
ZNF479 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 479
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1016s21c1
Sequence:CCGGGCCTTTAGCTGGTCTGCAAACCTCGAGGTTTGCAGACCAGCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1024s21c1
Sequence:CCGGCTGGTCTGCAAACCTTACTAGCTCGAGCTAGTAAGGTTTGCAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1366s21c1
Sequence:CCGGCTCGAACCTTATGAGACATAGCTCGAGCTATGTCTCATAAGGTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1357s21c1
Sequence:CCGGTAGCTTATCCTCGAACCTTATCTCGAGATAAGGTTCGAGGATAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033273.1-1857s21c1
Sequence:CCGGTCCACCCTCAGGCCTTATAATCTCGAGATTATAAGGCCTGAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033273
ZNF479 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 479
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1016s21c1
Sequence:CCGGGCCTTTAGCTGGTCTGCAAACCTCGAGGTTTGCAGACCAGCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1024s21c1
Sequence:CCGGCTGGTCTGCAAACCTTACTAGCTCGAGCTAGTAAGGTTTGCAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1366s21c1
Sequence:CCGGCTCGAACCTTATGAGACATAGCTCGAGCTATGTCTCATAAGGTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033273.1-1357s21c1
Sequence:CCGGTAGCTTATCCTCGAACCTTATCTCGAGATAAGGTTCGAGGATAAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033273.1-1857s21c1
Sequence:CCGGTCCACCCTCAGGCCTTATAATCTCGAGATTATAAGGCCTGAGGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks