EMAIL THIS PAGE TO A FRIEND

ZNF480

zinc finger protein 480

UniProtKB ID: Q8WV37, Q5JPG9, Q6P0Q4, Q8N1M5
Gene ID:
cow(790431) zinc finger protein 347-like
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144684 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242548 predicted 676
2 SASI_Hs02_00364587 predicted 1596
3 SASI_Hs01_00242549 predicted 480
4 SASI_Hs01_00242550 predicted 1437
5 SASI_Hs01_00242551 predicted 1434
6 SASI_Hs01_00242553 predicted 1261
7 SASI_Hs02_00364588 predicted 435
8 SASI_Hs01_00242554 predicted 1622
9 SASI_Hs01_00242555 predicted 1645
10 SASI_Hs01_00242557 predicted 373
11 SASI_Hs01_00242552 predicted 1338
12 SASI_Hs01_00242556 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144684
VALIDATED
ZNF480 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 480
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144684.1-3171s1c1
Sequence:CCGGGCCAATGCTATTTCTATCAAACTCGAGTTTGATAGAAATAGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_144684.1-470s1c1
Sequence:CCGGCCAGATGAAAGGGTAATAAATCTCGAGATTTATTACCCTTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-1426s1c1
Sequence:CCGGCAAGGCATTCAGACACAAGTTCTCGAGAACTTGTGTCTGAATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-1593s1c1
Sequence:CCGGGCAAGGCCTTTAGTCGCATTTCTCGAGAAATGCGACTAAAGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-665s1c1
Sequence:CCGGCATAGCAAAGTCTTTAGAGTACTCGAGTACTCTAAAGACTTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-469s21c1
Sequence:CCGGTCCAGATGAAAGGGTAATAAACTCGAGTTTATTACCCTTTCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-1429s21c1
Sequence:CCGGGGCATTCAGACACAAGTTATCCTCGAGGATAACTTGTGTCTGAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-1019s21c1
Sequence:GTACCGGCATAAGTCATCTCTAGCAAATCTCGAGATTTGCTAGAGATGACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144684.1-2306s21c1
Sequence:CCGGCTGGTACTCCTGACGAATATACTCGAGTATATTCGTCAGGAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-683s21c1
Sequence:CCGGGTATCTTCCAGCCTTACTAAACTCGAGTTTAGTAAGGCTGGAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144684
VALIDATED
ZNF480 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 480
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144684.1-3171s1c1
Sequence:CCGGGCCAATGCTATTTCTATCAAACTCGAGTTTGATAGAAATAGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_144684.1-470s1c1
Sequence:CCGGCCAGATGAAAGGGTAATAAATCTCGAGATTTATTACCCTTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-1426s1c1
Sequence:CCGGCAAGGCATTCAGACACAAGTTCTCGAGAACTTGTGTCTGAATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-1593s1c1
Sequence:CCGGGCAAGGCCTTTAGTCGCATTTCTCGAGAAATGCGACTAAAGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-665s1c1
Sequence:CCGGCATAGCAAAGTCTTTAGAGTACTCGAGTACTCTAAAGACTTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-469s21c1
Sequence:CCGGTCCAGATGAAAGGGTAATAAACTCGAGTTTATTACCCTTTCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-1429s21c1
Sequence:CCGGGGCATTCAGACACAAGTTATCCTCGAGGATAACTTGTGTCTGAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-1019s21c1
Sequence:GTACCGGCATAAGTCATCTCTAGCAAATCTCGAGATTTGCTAGAGATGACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144684.1-2306s21c1
Sequence:CCGGCTGGTACTCCTGACGAATATACTCGAGTATATTCGTCAGGAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-683s21c1
Sequence:CCGGGTATCTTCCAGCCTTACTAAACTCGAGTTTAGTAAGGCTGGAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144684
VALIDATED
ZNF480 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 480
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144684.1-3171s1c1
Sequence:CCGGGCCAATGCTATTTCTATCAAACTCGAGTTTGATAGAAATAGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_144684.1-470s1c1
Sequence:CCGGCCAGATGAAAGGGTAATAAATCTCGAGATTTATTACCCTTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-1426s1c1
Sequence:CCGGCAAGGCATTCAGACACAAGTTCTCGAGAACTTGTGTCTGAATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-1593s1c1
Sequence:CCGGGCAAGGCCTTTAGTCGCATTTCTCGAGAAATGCGACTAAAGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144684.1-665s1c1
Sequence:CCGGCATAGCAAAGTCTTTAGAGTACTCGAGTACTCTAAAGACTTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-469s21c1
Sequence:CCGGTCCAGATGAAAGGGTAATAAACTCGAGTTTATTACCCTTTCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-1429s21c1
Sequence:CCGGGGCATTCAGACACAAGTTATCCTCGAGGATAACTTGTGTCTGAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-1019s21c1
Sequence:GTACCGGCATAAGTCATCTCTAGCAAATCTCGAGATTTGCTAGAGATGACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144684.1-2306s21c1
Sequence:CCGGCTGGTACTCCTGACGAATATACTCGAGTATATTCGTCAGGAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144684.1-683s21c1
Sequence:CCGGGTATCTTCCAGCCTTACTAAACTCGAGTTTAGTAAGGCTGGAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks