EMAIL THIS PAGE TO A FRIEND

ZNF483

zinc finger protein 483

Synonyms: ZKSCAN16 ZSCAN48
UniProtKB ID: Q8TF39, Q5VZN2, Q8NAE1
Gene ID:
domestic cat(101100513) zinc finger protein 483
Horse(100058102) zinc finger protein 483
dog(481664) zinc finger protein 483
cow(539505) zinc finger protein 483
sheep(101121917) zinc finger protein 483
naked mole-rat(101711297) zinc finger protein 483
Domestic Rabbit(100352727) zinc finger protein 483
domestic guinea pig(100715855) zinc finger protein 483
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_088567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_088567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_088567 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069641 MISSION® esiRNA esiRNA human ZNF483 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007169 Rosetta Predictions human pricing
NM_133464 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173817 predicted 550
2 SASI_Hs01_00173818 predicted 567
3 SASI_Hs01_00173819 predicted 311
4 SASI_Hs01_00173820 predicted 650
5 SASI_Hs01_00173822 predicted 699
6 SASI_Hs01_00173823 predicted 370
7 SASI_Hs02_00305243 predicted 718
8 SASI_Hs01_00173824 predicted 712
9 SASI_Hs02_00305244 predicted 699
10 SASI_Hs02_00305245 predicted 720
11 SASI_Hs01_00173816 predicted 432
12 SASI_Hs01_00173821 predicted 727
13 SASI_Hs01_00173825 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159534 predicted 471
2 SASI_Hs01_00159535 predicted 495
3 SASI_Hs01_00159536 predicted 239
4 SASI_Hs01_00159537 predicted 568
5 SASI_Hs01_00159539 predicted 624
6 SASI_Hs01_00159540 predicted 302
7 SASI_Hs02_00363161 predicted 645
8 SASI_Hs01_00159541 predicted 641
9 SASI_Hs02_00363162 predicted 620
10 SASI_Hs02_00363163 predicted 640
11 SASI_Hs01_00159533 predicted 352
12 SASI_Hs01_00159538 predicted 655
13 SASI_Hs01_00159542 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_088567
ZNF483 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 483
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000017494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-2091s1c1
Sequence:CCGGCGTCTGTGATTTATCATCAAACTCGAGTTTGATGATAAATCACAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-2336s1c1
Sequence:CCGGCGAAGCTCAATCCTTGTAGAACTCGAGTTCTACAAGGATTGAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-1506s1c1
Sequence:CCGGCCTTAAATAAAGATGAGGGAACTCGAGTTCCCTCATCTTTATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-945s1c1
Sequence:CCGGCCCGACTAGATGAATCAGCTTCTCGAGAAGCTGATTCATCTAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_088567
ZNF483 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 483
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000017494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-2091s1c1
Sequence:CCGGCGTCTGTGATTTATCATCAAACTCGAGTTTGATGATAAATCACAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-2336s1c1
Sequence:CCGGCGAAGCTCAATCCTTGTAGAACTCGAGTTCTACAAGGATTGAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-1506s1c1
Sequence:CCGGCCTTAAATAAAGATGAGGGAACTCGAGTTCCCTCATCTTTATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-945s1c1
Sequence:CCGGCCCGACTAGATGAATCAGCTTCTCGAGAAGCTGATTCATCTAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_088567
ZNF483 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 483
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000017494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-2091s1c1
Sequence:CCGGCGTCTGTGATTTATCATCAAACTCGAGTTTGATGATAAATCACAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-2336s1c1
Sequence:CCGGCGAAGCTCAATCCTTGTAGAACTCGAGTTCTACAAGGATTGAGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-1506s1c1
Sequence:CCGGCCTTAAATAAAGATGAGGGAACTCGAGTTCCCTCATCTTTATTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088567.5-945s1c1
Sequence:CCGGCCCGACTAGATGAATCAGCTTCTCGAGAAGCTGATTCATCTAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks