EMAIL THIS PAGE TO A FRIEND

ZNF484

zinc finger protein 484

Synonyms: BA526D8.4
UniProtKB ID: Q5JVG2, B1AL89, B4DRI2
Gene ID:
domestic guinea pig(100726105) zinc finger protein 484
cow(538489) zinc finger protein 484
sheep(101110387) zinc finger protein 484
Horse(100054672) zinc finger protein 484
dog(484217) zinc finger protein 484
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031486 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023621 MISSION® esiRNA esiRNA human ZNF484 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007101 Rosetta Predictions human pricing
NM_031486 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176390 predicted 1836
2 SASI_Hs01_00176391 predicted 1682
3 SASI_Hs01_00176393 predicted 630
4 SASI_Hs02_00305225 predicted 479
5 SASI_Hs01_00176394 predicted 2015
6 SASI_Hs01_00176395 predicted 688
7 SASI_Hs01_00176396 predicted 924
8 SASI_Hs01_00176397 predicted 438
9 SASI_Hs01_00176398 predicted 2434
10 SASI_Hs02_00305226 predicted 816
11 SASI_Hs01_00176392 predicted 1768
12 SASI_Hs01_00176399 predicted 2543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072740 predicted 1895
2 SASI_Hs01_00072741 predicted 1751
3 SASI_Hs01_00072743 predicted 691
4 SASI_Hs02_00358923 predicted 545
5 SASI_Hs01_00072744 predicted 2083
6 SASI_Hs01_00072745 predicted 749
7 SASI_Hs01_00072746 predicted 987
8 SASI_Hs01_00072747 predicted 497
9 SASI_Hs01_00072748 predicted 2497
10 SASI_Hs02_00358924 predicted 882
11 SASI_Hs01_00072742 predicted 1834
12 SASI_Hs01_00072749 predicted 2607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031486
ZNF484 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 484
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031486.1-2737s1c1
Sequence:CCGGGCTGATGTGTAGTTACACATACTCGAGTATGTGTAACTACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-945s1c1
Sequence:CCGGGCCTTTGCACATGAGAGTATTCTCGAGAATACTCTCATGTGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-2499s1c1
Sequence:CCGGGCCTTCACCATCAGATCAAATCTCGAGATTTGATCTGATGGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-1089s1c1
Sequence:CCGGCTCAAGTCAAACCGTCAGAAACTCGAGTTTCTGACGGTTTGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-2016s1c1
Sequence:CCGGCTCCACGTACATCAGCAGATTCTCGAGAATCTGCTGATGTACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031486
ZNF484 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 484
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031486.1-2737s1c1
Sequence:CCGGGCTGATGTGTAGTTACACATACTCGAGTATGTGTAACTACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-945s1c1
Sequence:CCGGGCCTTTGCACATGAGAGTATTCTCGAGAATACTCTCATGTGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-2499s1c1
Sequence:CCGGGCCTTCACCATCAGATCAAATCTCGAGATTTGATCTGATGGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-1089s1c1
Sequence:CCGGCTCAAGTCAAACCGTCAGAAACTCGAGTTTCTGACGGTTTGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-2016s1c1
Sequence:CCGGCTCCACGTACATCAGCAGATTCTCGAGAATCTGCTGATGTACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031486
ZNF484 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 484
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031486.1-2737s1c1
Sequence:CCGGGCTGATGTGTAGTTACACATACTCGAGTATGTGTAACTACACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-945s1c1
Sequence:CCGGGCCTTTGCACATGAGAGTATTCTCGAGAATACTCTCATGTGCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-2499s1c1
Sequence:CCGGGCCTTCACCATCAGATCAAATCTCGAGATTTGATCTGATGGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-1089s1c1
Sequence:CCGGCTCAAGTCAAACCGTCAGAAACTCGAGTTTCTGACGGTTTGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031486.1-2016s1c1
Sequence:CCGGCTCCACGTACATCAGCAGATTCTCGAGAATCTGCTGATGTACGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks