EMAIL THIS PAGE TO A FRIEND

ZNF485

zinc finger protein 485

UniProtKB ID: Q8NCK3, Q96CL0
Gene ID:
domestic cat(101081675) zinc finger protein 485
dog(100687256) zinc finger protein 485
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145312 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145312 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010692 predicted 1036
2 SASI_Hs01_00010693 predicted 457
3 SASI_Hs01_00010694 predicted 482
4 SASI_Hs01_00010695 predicted 1026
5 SASI_Hs01_00010696 predicted 784
6 SASI_Hs01_00010697 predicted 1518
7 SASI_Hs01_00010698 predicted 788
8 SASI_Hs01_00010699 predicted 1331
9 SASI_Hs01_00010700 predicted 1236
10 SASI_Hs02_00365215 predicted 860
11 SASI_Hs01_00010691 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145312
ZNF485 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 485
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145312.2-1827s1c1
Sequence:CCGGCCCAGGAGTTTGAGTCTGTAACTCGAGTTACAGACTCAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-650s1c1
Sequence:CCGGCCAGTGAGAAACCACATAAATCTCGAGATTTATGTGGTTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-436s1c1
Sequence:CCGGGCAGTCGAGGATTACTGGTTTCTCGAGAAACCAGTAATCCTCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-472s1c1
Sequence:CCGGGCCCTAAAGCAAAGCACTTCTCTCGAGAGAAGTGCTTTGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-1124s1c1
Sequence:CCGGCAACTCTTATTAGTCACCAAACTCGAGTTTGGTGACTAATAAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1689s21c1
Sequence:CCGGGTCAGTATGGAAGTAGTTATACTCGAGTATAACTACTTCCATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1623s21c1
Sequence:CCGGACATCACTTGTGAGGATATTCCTCGAGGAATATCCTCACAAGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145312.3-779s21c1
Sequence:CCAGGAAGAAGCACTCAACGTTTATCTCGAGATAAACGTTGAGTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145312.3-1021s21c1
Sequence:CCGGGGAGAGCTTTCAGGGATAATTCTCGAGAATTATCCCTGAAAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1558s21c1
Sequence:CCGGCATCATAGAGGAGACATTAAACTCGAGTTTAATGTCTCCTCTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145312
ZNF485 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 485
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145312.2-1827s1c1
Sequence:CCGGCCCAGGAGTTTGAGTCTGTAACTCGAGTTACAGACTCAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-650s1c1
Sequence:CCGGCCAGTGAGAAACCACATAAATCTCGAGATTTATGTGGTTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-436s1c1
Sequence:CCGGGCAGTCGAGGATTACTGGTTTCTCGAGAAACCAGTAATCCTCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-472s1c1
Sequence:CCGGGCCCTAAAGCAAAGCACTTCTCTCGAGAGAAGTGCTTTGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-1124s1c1
Sequence:CCGGCAACTCTTATTAGTCACCAAACTCGAGTTTGGTGACTAATAAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1689s21c1
Sequence:CCGGGTCAGTATGGAAGTAGTTATACTCGAGTATAACTACTTCCATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1623s21c1
Sequence:CCGGACATCACTTGTGAGGATATTCCTCGAGGAATATCCTCACAAGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145312.3-779s21c1
Sequence:CCAGGAAGAAGCACTCAACGTTTATCTCGAGATAAACGTTGAGTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145312.3-1021s21c1
Sequence:CCGGGGAGAGCTTTCAGGGATAATTCTCGAGAATTATCCCTGAAAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1558s21c1
Sequence:CCGGCATCATAGAGGAGACATTAAACTCGAGTTTAATGTCTCCTCTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145312
ZNF485 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 485
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145312.2-1827s1c1
Sequence:CCGGCCCAGGAGTTTGAGTCTGTAACTCGAGTTACAGACTCAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-650s1c1
Sequence:CCGGCCAGTGAGAAACCACATAAATCTCGAGATTTATGTGGTTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-436s1c1
Sequence:CCGGGCAGTCGAGGATTACTGGTTTCTCGAGAAACCAGTAATCCTCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-472s1c1
Sequence:CCGGGCCCTAAAGCAAAGCACTTCTCTCGAGAGAAGTGCTTTGCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145312.2-1124s1c1
Sequence:CCGGCAACTCTTATTAGTCACCAAACTCGAGTTTGGTGACTAATAAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1689s21c1
Sequence:CCGGGTCAGTATGGAAGTAGTTATACTCGAGTATAACTACTTCCATACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1623s21c1
Sequence:CCGGACATCACTTGTGAGGATATTCCTCGAGGAATATCCTCACAAGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145312.3-779s21c1
Sequence:CCAGGAAGAAGCACTCAACGTTTATCTCGAGATAAACGTTGAGTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145312.3-1021s21c1
Sequence:CCGGGGAGAGCTTTCAGGGATAATTCTCGAGAATTATCCCTGAAAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145312.3-1558s21c1
Sequence:CCGGCATCATAGAGGAGACATTAAACTCGAGTTTAATGTCTCCTCTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks